FastQCFastQC Report
Tue 20 Dec 2016
MZM0403som_GATCAG_L001_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameMZM0403som_GATCAG_L001_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2479827
Sequences flagged as poor quality0
Sequence length15-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGT46260518.654728737125616No Hit
TACCCTGTAGAACCGAATGTGT1147354.626734042334404No Hit
TACCCTGTAGAACCGAATTTGCG946263.8158307010932617No Hit
TACCCTGTAGAACCGAATTTGC895603.611542256778396No Hit
AACATTCAACGCTGTCGGTGAG532952.1491418554600785No Hit
AACATTCAACGCTGTCGGTGAGT500802.019495714822042No Hit
ACCCTGTAGAACCGAATTTGCG391961.5805941301550472No Hit
ACCCTGTAGAACCGAATTTGTG285661.1519351954793622No Hit
TATTGCACTTGTCCCGGCCTGT275621.1114485002381216No Hit
TACCCTGTAGATCCGGATTTGT268681.0834626770335187No Hit
TTCAAGTAATCCAGGATAGGCT220280.8882877716872992No Hit
TAAGTGCTAACTGTTGGGGTAG171660.6922257076804148No Hit
ACCCTGTAGAACCGAATTTGT161070.6495211157875126No Hit
ACCCTGTAGAACCGAATTTGTGT150440.6066552223199441No Hit
TACCCTGTAGAACCGAATTTG131720.531166085376117No Hit
TACCCTGTAGAACCGAATTTGTG130250.5252382525071306No Hit
AACTCCAGTCACGAT129690.5229800304618024Illumina PCR Primer Index 9 (100% over 15bp)
TACCCTGTAGAACCGAATGTGTG122560.4942280247775349No Hit
TATTGCACTTGTCCCGGCCTGTAT118390.4774123356185734No Hit
AACTCCAGTCACGATCAGATCTCGTATGC112760.45470913898429205Illumina PCR Primer Index 9 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTAA99820.4025280795797449No Hit
AACATTCATTGCTGTCGGTGGG72960.2942140721913262No Hit
ACCCTGTAGAACCGAATTTGC71640.2888911202273384No Hit
AACTCCAGTCACGATC69490.28022116058902496Illumina PCR Primer Index 9 (100% over 16bp)
TACCCTGTAGATCCGGATTTGTG68710.27707577988303217No Hit
TAGCTTATCAGACTGGTGTTGGC68530.27634992279703385No Hit
AAGCTGCCAGCTGAAGAACTGT64780.2612279001720685No Hit
ACCCTGTAGAACCGAATGTGTG64670.26078432084173614No Hit
TCCTTCATTCCACCGGAGTCTG63170.25473551179174997No Hit
TAAGTGCTAACTGTTGGGGTAT60860.24542034585477132No Hit
AACATTCATTGCTGTCGGTGGGT60770.24505741731177216No Hit
TATTGCACTTGTCCCGGCCTGTA58040.23404858484079735No Hit
CGTCAACATCGGCCGGGCCC56010.22586252992648276No Hit
TACCCTGTAGAACCGAATGTGG55590.22416886339248665No Hit
ACCCTGTAGAACCGAATGTGT54270.21884591142849885No Hit
ACCCTGTAGAACCGAATTTGTGA54110.21820070512983364No Hit
AACATTCAACGCTGTCGGTGA52780.2128374277721793No Hit
AACTCCAGTCACGATCA50810.20489332521986414Illumina PCR Primer Index 9 (100% over 17bp)
TGTGCAAATCCATGCAAAACTG48740.19654596873088323No Hit
TACCCTGTAGAACCGAATGTGTGT46240.18646462031423966No Hit
TCCTTCATTCCACCGGAGTCTGT45450.18327891421458029No Hit
TAAAGCTAGAGAACCGAAAGTA45040.18162557307425076No Hit
CATTGCACTTGTCTCGGTCTGA41890.1689230740692798No Hit
AACTCCAGTCACGATCAG41160.1659793203316199Illumina PCR Primer Index 9 (100% over 18bp)
TTCCAGTGATGACAGCCTATAATCTGACT40610.1637614236799583No Hit
ACCCTGTAGAACCGAATTTGTGG39950.1610999476979644No Hit
TAAGTGCTAACTGTTGGGGTATT38130.1537607260506479No Hit
TTTGGCAATGGTAGAACTCACA37900.15283324199631668No Hit
TAAGTGCTACATGTTGGAGTCA35040.14130017940767642No Hit
TATTGCACTTGTCCCGGCCTGTAG33580.13541267193235657No Hit
TATTGCACTTGTCCCGGCCTG33240.13404160854769306No Hit
TAAGTGCTACATGTTGGAGTC33100.133477053036361No Hit
AACTCCAGTCACGATCAGA32690.13182371189603145Illumina PCR Primer Index 9 (100% over 19bp)
TATTGCACTTGTCCCGGCCTGTT31650.12762987095470774No Hit
ACCCTGTAGAACCGAATGTGTGA30170.12166171269205474No Hit
ATGACCTATGAATTGACAGCC29470.11883893513539452No Hit
TTTGGCAATGGTAGAACTCACAC28450.11472574498140393No Hit
TAAGTGCTATTTGTTGGGGAAG28400.11452411801307107No Hit
TTTGGCAATGGTAGAACTCACACT27950.11270947529807523No Hit
TACCCTGTAGATCCGGATTTGTGT27350.11028995167808077No Hit
GTGAAATGTTTAGGACCACTTG25770.10391853947876203No Hit
CCTGTCTGAGGGTCGCT25360.10226519833843248No Hit
AGCTACATCTGGCTACTGGGTCTC25240.1017812936144336No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC12050.0277.6979423
ACGCGCT251.6841113E-7241.1718823
AGAAGCC3750.0233.1328423
AAATAGC2450.0190.7226723
TAAGCCA552.6921043E-10164.4353823
GAGCACC3400.0159.5990423
ACACGCC2150.0147.2270423
CGGCGCT1050.0143.554723
TCTGACT10750.0140.2162223
CAACCCG1200.0138.171423
TCGTATG12400.0137.525122
ATAACTA1650.0130.8826922
ATATGCC351.5752448E-9127.6589822
ATTATCA505.3153763E-6120.5859423
CACCCGC900.0115.8387122
TAACTGA5800.0114.3487423
GAGTCCC959.458745E-11111.06623
TCAGGCT4050.0104.21007523
CATCCGA455.283896E-4100.4882923
CCGGCGC6850.099.021323