FastQCFastQC Report
Mon 19 Dec 2016
MZM0403som_GATCAG_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameMZM0403som_GATCAG_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3516736
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA44443812.637798231087007RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1099493.1264502083750387RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC910012.5876551438606707RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA860772.447638947023604RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA512871.4583693515805565RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC483441.3746837977033248RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA376031.0692585397368468RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA274480.7804964603541467RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA263590.7495302462283208RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA259340.7374451764363319RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC233300.6633992429343573No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA204940.5827562830988735RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG178310.5070326575551876No Hit
TAAGTGCTAACTGTTGGGGTAGTGGAATTCTCGGGTGCCAAGGAACTCCA165450.47046465813754573RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG154250.43861694480336316RNA PCR Primer, Index 1 (100% over 29bp)
ACCCTGTAGAACCGAATTTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC145010.41234258130266244RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC125530.35695030846785203RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG124650.35444798813445194RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC118010.33556684380061513RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG115140.32740586725873083No Hit
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC113880.3238229995086353RNA PCR Primer, Index 1 (100% over 26bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC110330.31372841180003275RNA PCR Primer, Index 9 (100% over 50bp)
CAGGGCGCAAGGGGTCTGCGGCGATGTCGGCTTGGAATTCTCGGGTGCCA109740.3120507197583213No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTTGGAATTC99620.2832740359242207No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGG97470.2771604123823909No Hit
TATTGCACTTGTCCCGGCCTGTAATGGAATTCTCGGGTGCCAAGGAACTC96190.2735206737156272RNA PCR Primer, Index 1 (100% over 26bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA93300.26530282625707474No Hit
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGGGCCAAGGAACTCCA84390.2399668328813991RNA PCR Primer, Index 1 (96% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT83940.238687237256365No Hit
CATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCG77390.22006201204753498No Hit
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA75120.21360716300569618No Hit
CAGGGCGCAAGGGGTCTGCGGCGATGTCGGCTGGAATTCTCGGGTGCCAA73410.20874469963056652No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC72300.20558836375548237No Hit
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA69730.19828045096362082RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG68490.19475445413019346RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG66890.1902047807967388No Hit
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC66430.1888967497133706RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC65780.18704844492165462RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA62330.177238211796393RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA62140.17669793808804526RNA PCR Primer, Index 1 (100% over 28bp)
TTACTTGGATAACTGTGGCAATTCTAGAGCTAATACATGCAAACTGGAAT61560.17504868150466796No Hit
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA61230.17411031137964295No Hit
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA60850.17302976396294745RNA PCR Primer, Index 1 (100% over 28bp)
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTGGAATTCT60440.1718639101712497No Hit
TTGTTGTGATGAAACTAAACTGAAAATAGCTGGAATTCTCGGGTGCCAAG59700.16975968625452692No Hit
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC59570.16939002529618374No Hit
TAAGTGCTAACTGTTGGGGTATTGGAATTCTCGGGTGCCAAGGAACTCCA58520.1664043021711041RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC58330.16586402846275639RNA PCR Primer, Index 1 (100% over 27bp)
CATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTTGGAATT55710.15841393837922438No Hit
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC55490.15778835829587434RNA PCR Primer, Index 1 (100% over 27bp)
CGTCAACATCGGCCGGGCCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT53400.1518453475040492RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGAACCGAATGTGGTGGAATTCTCGGGTGCCAAGGAACTCCA53140.15110602558736283RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC52030.14794968971227865RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG51810.14732410962892864RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG50670.1440824673788422RNA PCR Primer, Index 1 (100% over 29bp)
TGTGCAAATCCATGCAAAACTGTGGAATTCTCGGGTGCCAAGGAACTCCA46820.13313481592021692RNA PCR Primer, Index 1 (100% over 28bp)
CATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTGGAATTC45260.12869888442009864No Hit
TACCCTGTAGAACCGAATGTGTGTTGGAATTCTCGGGTGCCAAGGAACTC44650.12696432146171904RNA PCR Primer, Index 1 (100% over 26bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC43690.12423451746164625RNA PCR Primer, Index 1 (100% over 27bp)
TAGCGCCGCGAATCTTCGGTTGGTCCCGGATAGCTGGCCCTCGGGCCGGT43660.12414921108664398No Hit
TGACTGTGATGAGCTCTTTATCCCGAATCTGAACATCTATTGATGAAACA43590.12395016287830535No Hit
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA43180.12278430908660759RNA PCR Primer, Index 1 (100% over 28bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA43150.12269900271160529No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA41750.11871803854483248No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA40400.1148792516697301RNA PCR Primer, Index 1 (100% over 28bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG39940.1135712205863619Illumina Small RNA Adapter 2 (100% over 21bp)
TCCCTGATGGTCTAGTGGCTAGGATCCGACGCTTGGAATTCTCGGGTGCC39910.11348591421135963No Hit
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAT39630.11268972137800505RNA PCR Primer, Index 9 (100% over 36bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC39490.11229162496132777No Hit
ACCCTGTAGAACCGAATTTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC38420.10924903091957998RNA PCR Primer, Index 1 (100% over 27bp)
CCTACTCGAAACCCCGTGGCGCAATGAAAGTGAAGGCCGGCGCTGGAATT38300.10890780541957087No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC38200.10862345083622997No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCGG37570.10683201696118219No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC37280.10600738866949352No Hit
TAAGTGCTAACTGTTGGGGTATTTGGAATTCTCGGGTGCCAAGGAACTCC36870.10484153487779577RNA PCR Primer, Index 1 (100% over 27bp)
TTTGGCAATGGTAGAACTCACATGGAATTCTCGGGTGCCAAGGAACTCCA36600.1040737775027753RNA PCR Primer, Index 1 (100% over 28bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCTACGC750.043.994279
TCAACGC116800.043.9365236
CAACGCT117000.043.8426137
TACCCTG900050.043.8343771
ACATTCA135600.043.7877432
CATTCAA117150.043.786483
AACATTC135200.043.7255481
TTCAACG117750.043.6941265
TATTGCA80600.043.5978971
CTTGTCC75750.043.5006078
TTGTCCC75700.043.5002829
CGCTGTC118600.043.4378510
CTGTCGG134250.043.404412
ACGCTGT118450.043.344299
ATTCAAC118700.043.3073654
ACTTGTC82950.043.3035557
GCTGTCG137300.043.25729411
TGTCCCG76450.043.18861810
CATTCAT18800.043.1739963
CGTAGTG33300.043.1342966