FastQCFastQC Report
Tue 6 Dec 2016
P1_ATCACG_L004_R1_001_prinseq_good_uBZ1.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameP1_ATCACG_L004_R1_001_prinseq_good_uBZ1.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences35203627
Sequences flagged as poor quality0
Sequence length15-50
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG25454187.230556101506245No Hit
TTCAAGTAATCCAGGATAGGCT17942485.096770284493697No Hit
TCACAGTGAACCGGTCTCTTT14386624.086686863259857No Hit
AACATTCAACGCTGTCGGTGAGT13592253.861036818734615No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT11446443.2514945121989847No Hit
TGAGGTAGTAGGTTGTATAGTT10764383.0577474303997145No Hit
AACATTCAACGCTGTCGGTGA6885031.9557729094220888No Hit
TCACAGTGAACCGGTCTCTT6073761.7253222231902412No Hit
TTAAAGGGAATTTGCGACTGTT4861081.3808463542691212No Hit
TCTTTGGTTATCTAGCTGTAT4412011.253282793843941No Hit
TGAGGTAGTAGGTTGTATAGT3295910.9362415980603364No Hit
TACCCTGTAGATCCGGATTTGT3012520.8557413700582612No Hit
AGCTACATCTGGCTACTGGGTCTC2930230.8323659377484031No Hit
TGAGGTAGTAGTTTGTGCTGTT2860310.8125043479184687No Hit
AACATTCATTGCTGTCGGTGGG2674430.7597029703785919No Hit
TGAGGTAGTAGTTTGTATAGTT2598920.7382534759841649No Hit
TCACAGTGAACCGGTCTCTTTT2527650.718008402940981No Hit
TTCACAGTGGCTAAGTTCTG2512060.7135798819820469No Hit
TCTTTGGTTATCTAGCTGTATGA2463380.6997517613739062No Hit
TCCCTGAGACCCTTAACCTGTG2243690.637346259804423No Hit
AAGCTGCCAGCTGAAGAACT2175460.6179647341451493No Hit
TAACAGTCTACAGTCATGGCT2089700.5936036079464199No Hit
TAAAGGGAATTTGCGACTGTT2026110.5755401282941669No Hit
TCCCTGAGACCCTTAACCTGT1954650.5552410835394886No Hit
TAGCTTATCAGACTGGTGTTGGC1791790.508978804939616No Hit
AAGCTGCCAGCTGAAGAACTGT1786920.507595424755523No Hit
TCTTTGGTTATCTAGCTGTATG1719330.48839569854549364No Hit
TTGCATAGTCACAAAAGTGATC1668550.47397104849452015No Hit
TCCAGCATCAGTGATTTTGTT1569010.44569555290425045No Hit
TAAAGCTAGAGAACCGAAAGT1509460.4287796822753519No Hit
AGCTACATCTGGCTACTGGGTCT1496340.4250527935658448No Hit
TCCCTGAGACCCTTAACCTGTGA1469870.41753368196975843No Hit
TCACAGTGAACCGGTCTCT1455070.4133295697059851No Hit
AGCTACATTGTCTGCTGGGTTT1411800.4010382225672372No Hit
TAAAGCTAGAGAACCGAAAGTA1406100.39941907122240555No Hit
TATTGCACTCGTCCCGGCCTCC1399430.39752438008731317No Hit
AACATTCATTGCTGTCGGTGGGT1300150.36932274052329894No Hit
ACCGTGGCTTTAGATTGTTACT1297970.3687034861493107No Hit
AACCCGTAGATCCGAACTTGTG1288830.36610716276479127No Hit
ACCTTGGCTTTAGACTGCTTACT1280120.3636329858852328No Hit
TTCACAGTGGCTAAGTTCTGC1243250.35315963323892735No Hit
TGAGGTAGTAGATTGAATAGTT1207510.34300727024519373No Hit
AGAATAATGCCAGCAGTCGGTC1193700.3390843790044702No Hit
CAGGCTGGTTAGATGGTTGTCT1149830.32662259488205575No Hit
TGAGGTAGTTGGTTGTATGGTT1148860.32634705509179496No Hit
CGGACAACTCTTAGCGG1140870.3240774025926363No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGC1128470.3205550382635289No Hit
TACCCTGTAGAACCGAATTTGT1106160.31421762308753015No Hit
TTCAAGTAATCCAGGATAGGC1071040.30424137831025194No Hit
CCCTGAGACCCTTAACCTGTGA1005260.2855558036676164No Hit
TCCCTGAGACCCTAACTTGTGA969490.2753949188246995No Hit
AACATTCAACGCTGTCGGTGAGA939040.2667452419036254No Hit
TAACGGAACCCATAATGCAGCTG922830.2621406027282359No Hit
AACATTCAACGCTGTCGGTGG902640.25640539822785874No Hit
TATTGCACTTGTCCCGGCCTGT901100.25596794330311473No Hit
TTCCCTTTGTCATCCTATGCCTG867810.24651153132601933No Hit
AACCCGTAGATCCGAACTTGT804530.22853611078199415No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCC785370.2230934897702444No Hit
TTCAAGTAATCCAGGATAGGCTT743200.21111461043488502No Hit
AGCTGGTGTTGTGAATCAGGCCG735070.20880518930620415No Hit
TGCTCAGTAGTCAGTGTAGATC721560.2049675165573138No Hit
CCTTGGCTTTAGACTGCTTACT711620.20214394386123907No Hit
TACCCTGTAGAACCGAATTTGC706890.20080033230666827No Hit
GAATACCAGGTGCTGTAAGCTT687220.19521283985880206No Hit
TACCCTGTAGAACCGAATGTGT664390.18872771263029234No Hit
TTCCCTTTGTCATCCTATGCCT660130.1875176100462603No Hit
TGAGGTAGTAGGTTGTATAGTTT635490.18051833125035668No Hit
TCTTTGGTTATCTAGCTGTATGT618340.17564667413388968No Hit
TACCCTGTAGAACCGAATTTGCG596900.16955639258420732No Hit
ACCATCGACCGTTGACTGTACC595310.16910473457749112No Hit
CCGGACAACTCTTAGCGG588040.16703960645873223No Hit
CCTGTCTGAGGGTCGCT587250.16681519776357137No Hit
TCCAGCATCAGTGATTTTGTTG580080.16477847580875687No Hit
TGAGGTAGTAGTTTGTATAGT574270.1631280776835864No Hit
TGAGATGAAGCACTGTAGCTC563010.15992954362344539No Hit
AGCTACATTGTCTGCTGGGTT560730.15928188308551275No Hit
AACATTCAACGCTGTCGGTG556740.15814847714413063No Hit
CTTTGGTTATCTAGCTGTATGA550620.1564100199107325No Hit
TCTTTGGTTATCTAGCTGTAA548750.15587882464497196No Hit
TAACAGTCTACAGCCATGGTCG547860.1556260097858667No Hit
TTCAAGTAATCCAGGATAGGTT539110.15314047044073045No Hit
TGAGGTAGTAGGTTGTGTGGTT531690.15103273307605491No Hit
GTACAGTACTGTGATAACTGA515360.1463940065039321No Hit
TACAGTACTGTGATAACTGAAG500580.14219557547294773No Hit
TGCTCAGTAGTCAGTGTAGATCC488480.1387584296356736No Hit
TCCCTGAGACCCTAACTTGTG482650.13710235027771428No Hit
TGAGGTAGTAGATTGAATAGT475730.13513664373276082No Hit
AGCAGCATTGTACAGGGCTATGA474390.13475600113590566No Hit
TGAGATGAAGCACTGTAGCTCT461180.13100354687884858No Hit
AAGCTGCCAGTTGAAGAGCTGT454250.12903499971750068No Hit
ACCATCGACCGTTGACTGTGCC450640.12800953719910735No Hit
TAGCAGCACGTAAATATTGGAG449190.12759764782191335No Hit
TAAAGCTAGAGAACCGAAAGTAA448830.12749538563171345No Hit
TGAGGTAGTAGTTTGTGCTGTTT446200.12674830351997537No Hit
TAAAGGGAATTTGCGACTGTTA444290.12620574578863705No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGC439040.12471442218155533No Hit
TAAGGCACGCGGTGAATGCC437690.12433093896830574No Hit
AGCTACATTGTCTGCTGGGTTTC421210.1196496031502663No Hit
TGAGGTAGTTGTTTGTACAGTT412300.11711861394281901No Hit
AATACCAGGTGCTGTAAGCTT407820.11584601779810925No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC399870.11358772776452834No Hit
TAACAGTCTACAGCCATGGTC393470.11176973327208586No Hit
TAGCTTATCAGACTGGTGTTGG387680.11012501637970427No Hit
ATAGCTCTTTAAATGGTACTGC385840.10960234296312707No Hit
AACATTCAACGCTGTCGGTGT383170.10884389838581121No Hit
AAGCCCTTACCCCAAAAAGCAT380970.1082189627790341No Hit
TGAGGTAGTAGTTTGTGCTGTTA369700.10501758810249864No Hit
ATACCAGGTGCTGTAAGCTT366730.10417392503334956No Hit
AGCAGCATTGTACAGGGCTATGT362810.1030604034067285No Hit
TACCCTGTAGATCCGGATTTGTG361410.10266271711150672No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGC354760.10077370720920319No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATACTT1700.01822.008344
GAAGTCA4950.01713.984144
GACTGAT15450.01708.437144
ACCCTCC2850.01653.844444
AAAAGAT4200.01474.959144
GTATACT2000.01444.749643
ACGCAGC5700.01366.506143
CAAAAGA4350.01328.505443
TGAAGTC6150.01286.945643
TTCAAAA3800.01276.1241
CAGTCAC9700.01166.216144
ATGAAGT6300.01156.49442
CACCCTC3850.01142.094643
CAAAGAA50200.01106.055939
CATTATG750.01077.361544
ATGTATA2300.01031.756741
CCAAAGA47650.0999.877938
CACTCAC1900.0992.306644
AGGTGCC6500.0979.5431540
CCACTCA3300.0951.745543