FastQCFastQC Report
Tue 6 Dec 2016
P2_CGATGT_L004_R1_001_prinseq_good_3U92.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameP2_CGATGT_L004_R1_001_prinseq_good_3U92.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences34655232
Sequences flagged as poor quality0
Sequence length15-50
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG31623379.125135852502734No Hit
TTCAAGTAATCCAGGATAGGCT18371785.301300536669326No Hit
AACATTCAACGCTGTCGGTGAGT15246394.399448256471058No Hit
TGAGGTAGTAGGTTGTATAGTT14867754.29018914084892No Hit
TCACAGTGAACCGGTCTCTTT13049333.7654718340941993No Hit
AACATTCAACGCTGTCGGTGA7308772.1089946822459593No Hit
TTAAAGGGAATTTGCGACTGTT5885821.698392900673699No Hit
TACCCTGTAGATCCGGATTTGT5361471.5470881857030996No Hit
TCACAGTGAACCGGTCTCTT5230451.5092814845389002No Hit
TCTTTGGTTATCTAGCTGTAT4507811.3007588579986997No Hit
TGAGGTAGTAGTTTGTATAGTT3970441.1456971345625389No Hit
TGAGGTAGTAGGTTGTATAGT3823571.103316809421446No Hit
AACATTCATTGCTGTCGGTGGG3463270.9993498240034867No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT3301440.9526526903643294No Hit
TTCACAGTGGCTAAGTTCTG3113760.8984963655704281No Hit
TGAGGTAGTAGTTTGTGCTGTT3031840.8748577992494755No Hit
TACCCTGTAGAACCGAATTTGT2862210.8259099232115947No Hit
TCTTTGGTTATCTAGCTGTATGA2769410.7991318598011405No Hit
AGCTACATCTGGCTACTGGGTCTC2683500.7743419521762256No Hit
TCCCTGAGACCCTTAACCTGTG2582750.7452698628593801No Hit
TAACAGTCTACAGTCATGGCT2507590.7235819399506546No Hit
TAAAGGGAATTTGCGACTGTT2387640.6889695616523358No Hit
TCACAGTGAACCGGTCTCTTTT2276120.6567897164849452No Hit
TTGCATAGTCACAAAAGTGATC2235600.6450973982802943No Hit
AAGCTGCCAGCTGAAGAACT2141140.6178403307183169No Hit
TCCAGCATCAGTGATTTTGTT2006100.5788736315486215No Hit
TATTGCACTCGTCCCGGCCTCC1996610.5761352282968413No Hit
AAGCTGCCAGCTGAAGAACTGT1843400.5319254535649913No Hit
TACCCTGTAGAACCGAATGTGT1833160.5289706327748722No Hit
TCTTTGGTTATCTAGCTGTATG1790710.5167214001048961No Hit
AACATTCATTGCTGTCGGTGGGT1700300.4906329872499483No Hit
TCCCTGAGACCCTTAACCTGT1664840.4804007660372899No Hit
TCCCTGAGACCCTTAACCTGTGA1650120.47615321115149367No Hit
TTCACAGTGGCTAAGTTCTGC1634870.4717527212052714No Hit
AGCTACATCTGGCTACTGGGTCT1474670.4255259350161038No Hit
TACCCTGTAGAACCGAATTTGC1385680.39984727270041076No Hit
TAAAGCTAGAGAACCGAAAGTA1382580.398952746875277No Hit
ACCTTGGCTTTAGACTGCTTACT1365710.39408479504624294No Hit
AGAATAATGCCAGCAGTCGGTC1353070.39043743813343973No Hit
TAAAGCTAGAGAACCGAAAGT1342960.3875201297166327No Hit
CGGACAACTCTTAGCGG1318310.3804072066232308No Hit
TGAGGTAGTAGATTGAATAGTT1304520.37642800948497473No Hit
TAGCTTATCAGACTGGTGTTGGC1288260.37173607725378954No Hit
TGAGGTAGTTGGTTGTATGGTT1272050.36705857285849364No Hit
AACCCGTAGATCCGAACTTGTG1254170.3618991787444967No Hit
TCACAGTGAACCGGTCTCT1234880.35633291965842273No Hit
ACCGTGGCTTTAGATTGTTACT1210360.3492575089383329No Hit
CAGGCTGGTTAGATGGTTGTCT1169780.3375478773306149No Hit
CCCTGAGACCCTTAACCTGTGA1161370.3351211153340425No Hit
TACCCTGTAGAACCGAATTTGCG1120200.3232412352628313No Hit
TTCCCTTTGTCATCCTATGCCTG1111590.32075676192270186No Hit
AGCTACATTGTCTGCTGGGTTT1068430.3083026539830984No Hit
TCCCTGAGACCCTAACTTGTGA1054410.30425708879975183No Hit
TTCAAGTAATCCAGGATAGGC1047110.3021506247599208No Hit
AACATTCAACGCTGTCGGTGAGA977130.28195742564932186No Hit
TGAGGTAGTAGGTTGTATAGTTT954430.27540718815560083No Hit
TATTGCACTTGTCCCGGCCTGT888540.2563941860207428No Hit
AGCTGGTGTTGTGAATCAGGCCG878080.25337588275271106No Hit
TTCCCTTTGTCATCCTATGCCT845580.2439977894246964No Hit
TCTTTGGTTATCTAGCTGTATGT786530.2269585152394882No Hit
CTTTGGTTATCTAGCTGTATGA779140.2248260810950566No Hit
ACCATCGACCGTTGACTGTACC770920.22245414487486334No Hit
TCCAGCATCAGTGATTTTGTTG770680.22238489126259492No Hit
TTCAAGTAATCCAGGATAGGCTT760290.2193867869648081No Hit
AACATTCAACGCTGTCGGTGG753940.2175544518068729No Hit
TGCTCAGTAGTCAGTGTAGATC745220.21503823722778714No Hit
TGAGGTAGTAGTTTGTATAGT733010.21151495970363146No Hit
CCGGACAACTCTTAGCGG703920.20312084478326392No Hit
CCTTGGCTTTAGACTGCTTACT671240.19369081124604792No Hit
TACCCTGTAGATCCGGATTTGTG662280.19110534305469373No Hit
TAACAGTCTACAGCCATGGTCG653270.18850544702745028No Hit
CCTGTCTGAGGGTCGCT630340.18188884148863874No Hit
TGAGGTAGTAGGTTGTGTGGTT629950.18177630436870254No Hit
AACCCGTAGATCCGAACTTGT611670.17650148756759154No Hit
TGAGATGAAGCACTGTAGCTC607020.17515969882989096No Hit
TTCAAGTAATCCAGGATAGGTT602340.17380925339065686No Hit
AAGCTGCCAGTTGAAGAGCTGT585150.16884896341193156No Hit
ACCATCGACCGTTGACTGTGCC579750.16729075713589223No Hit
AACATTCAACGCTGTCGGTG575430.16604419211506072No Hit
TCTTTGGTTATCTAGCTGTAA537480.15509346467511745No Hit
TCCCTGAGACCCTAACTTGTG515690.14880581379458085No Hit
TAAGGCACGCGGTGAATGCC515470.14874233131666814No Hit
TACAGTACTGTGATAACTGAAG501530.1447198506707443No Hit
TAACAGTCTACAGCCATGGTC500760.1444976619980498No Hit
TGCTCAGTAGTCAGTGTAGATCC499410.14410811042903998No Hit
AGCAGCATTGTACAGGGCTATGA484140.13970184934846203No Hit
TAAAGGGAATTTGCGACTGTTA479410.13833697607333867No Hit
TGAGATGAAGCACTGTAGCTCT476530.13750593272611766No Hit
TGAGGTAGTAGTTTGTGCTGTTT476500.13749727602458411No Hit
TGAGGTAGTTGTTTGTACAGTT476130.13739051003900363No Hit
TGAGGTAGTAGATTGAATAGT466940.13473867380255886No Hit
AAGCCCTTACCCCAAAAAGCAT463550.13376046652926749No Hit
GTACAGTACTGTGATAACTGA458200.13221668808911738No Hit
TTTGGCAATGGTAGAACTCACA436440.12593769391011436No Hit
AGCTACATTGTCTGCTGGGTT435640.1257068485358863No Hit
CTCTCACTGTCGACCTTGACTAGCCT427380.12332337004698166No Hit
TATTGCACTCGTCCCGGCCTC421110.12151411942646928No Hit
ATAGCTCTTTAAATGGTACTGC420590.12136406993322105No Hit
TGATGTAGTAGGTTGTATAGTT406620.11733293258576367No Hit
TAGCTTATCAGACTGGTGTTGG404350.11667790883639158No Hit
TAAAGCTAGAGAACCGAAAGTAA403130.11632586964069379No Hit
TTCACAGTGGCTAAGTTCTGCA402780.11622487478946902No Hit
TACCCTGTAGAACCGAATGTGTG402170.11604885519162011No Hit
TAGCAGCACGTAAATATTGGAG401300.11579781084714712No Hit
TACCCTGTAGAACCGAATTTG394980.1139741323907455No Hit
TCTTTGGTTATCTAGCTGTA385130.11113184872056259No Hit
AGCAGCATTGTACAGGGCTATGT377490.10892727539668469No Hit
AACATTCAACGCTGTCGGTGT376950.10877145476908075No Hit
TATGGCTTTTTATTCCTATCTG371390.10716707941819578No Hit
CATTATTACTTTTGGTACGCG367910.10616290204030375No Hit
TTCACAGTGGTTAAGTTCTG362170.10450658648021748No Hit
CTTTTTGCGGTCTGGGCTTGC361420.10429016894187867No Hit
AGCTACATTGTCTGCTGGGTTTC359140.10363225962532874No Hit
ACCATCGACCGTTGACTGTGCCT357290.10309842969742636No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGATAAT50.00101883622834.900642
CTTCTAC50.00135244252460.537440
ACCCTCC2900.02364.673844
GACTGAT16150.02231.704644
AAAAGAT2950.02216.473944
TATACTT1400.02164.344244
GAAGTCA5400.02155.906544
ACGCAGC4550.02102.475643
CCGCGTA50.00190824772071.42138
GTATACT1400.02060.759843
TGAAGTC5500.02043.011643
CAAAAGA3250.01915.588943
ATGAAGT5850.01793.01442
CTAAAAG800.01771.812942
CACCCTC3800.01718.251243
GAAATAT750.01619.684843
CCCAATT100.0032187381594.780244
GTATACG1000.01594.7844
TTCAAAA3500.01579.882441
GCGTGCG100.0035504251518.454643