FastQCFastQC Report
Wed 21 Dec 2016
Pool3_Index1_ATCACG_L007_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index1_ATCACG_L007_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences25205272
Sequences flagged as poor quality0
Sequence length15-29
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGT17296196.862131858763516No Hit
AACTCCAGTCACATCACGATCTCGTATGC10359174.109921924270446Illumina PCR Primer Index 1 (100% over 29bp)
AACTCCAGTCACATC8758363.4748127296543356Illumina PCR Primer Index 1 (100% over 15bp)
AACTCCAGTCACATCA7432792.9489029120574455Illumina PCR Primer Index 1 (100% over 16bp)
GCACCGAAGCTGTGGACTTGC7124292.8265078829540107No Hit
AACTCCAGTCACATCAC5870992.329270638301384Illumina PCR Primer Index 1 (100% over 17bp)
TACCCTGTAGAACCGAATTTGCG5660902.2459190283683506No Hit
AACTCCAGTCACATCACG4646381.8434159329841788Illumina PCR Primer Index 1 (100% over 18bp)
TACCCTGTAGAACCGAATGTGT4057121.6096315088367226No Hit
GCACCGAAGCTGTGGACTT3861241.5319176083479678No Hit
AACTCCAGTCACATCACGA3562841.4135296774420845Illumina PCR Primer Index 1 (100% over 19bp)
TGCACCGAAGCTGTGGACTTGCA2939621.1662718815333555No Hit
GCACCGAAGCTGTGGACT2902481.1515368689534475No Hit
AACTCCAGTCACATCACGAT2452780.9731218135634481No Hit
TGCACCGAAGCTGTGGACTTGC1781720.7068838614397813No Hit
AACTCCAGTCACATCACGATC1755680.6965526894532224Illumina PCR Primer Index 1 (100% over 21bp)
ACCCTGTAGAACCGAATTTGCG1753030.6955013221043598No Hit
TACCCTGTAGAACCGAATTTGC1673700.6640277478457681No Hit
ATGCACCGAAGCTGTGGACTTGCA1315060.5217400550170616No Hit
GCACCGAAGCTGTGGACTTGCA1182010.4689534792562445No Hit
AACTCCAGTCACATCACGATCT1129150.44798167621440466Illumina PCR Primer Index 1 (100% over 22bp)
TAAGTGCTAACTGTTGGGGTAG982130.3896526091843008No Hit
ACCCTGTAGAACCGAATTTGTG921600.3656377919666965No Hit
ACCCTGTAGAACCGAATTTGTGT844460.33503308355490075No Hit
TATTGCACTTGTCCCGGCCTGT757800.30065138753511567No Hit
TACCCTGTAGAACCGAATGTGTG714130.28332564711065206No Hit
CAGAAGACTGCAGAGATGC697290.2766445051654273No Hit
ATGCACCGAAGCTGTGGACTTGC686130.27221686002833057No Hit
AACTCCAGTCACATCACGATCTC631480.2505348880980138Illumina PCR Primer Index 1 (100% over 23bp)
TACCCTGTAGAACCGAATTTGTG547590.21725216851458695No Hit
ATTGATCGGTTTAGAAATAGAC419200.16631441231818486No Hit
CATGCACCGAAGCTGTGGACTTGCA418170.16590576765051376No Hit
TAGCTTATCAGACTGGTGTTGGC398590.15813755154080464No Hit
ATTAAGTAGACCGCCT349070.13849086810092745No Hit
TACCCTGTAGATCCGGATTTGT329680.13079803304641982No Hit
AAGGCGCTTGAGAGAACTCTGGT318880.1265132151718101No Hit
CTAATGCTGAGATACGAGACGAGCC314590.12481119029384012No Hit
ACCCTGTAGAACCGAATGTGTG313090.12421607670014433No Hit
GCACCGAAGCTGTGGAC313090.12421607670014433No Hit
AACATTCAACGCTGTCGGTGAG305970.12139127084206827No Hit
AACATTCAACGCTGTCGGTGAGT297510.11803483017362398No Hit
CATGCACCGAAGCTGTGGACTTGC294190.1167176454195773No Hit
AGGCGCTTGAGAGAACTCTGGT285690.11334533505530113No Hit
CAAGGCGCTTGAGAGAACTCTGGT279010.11069509585137585No Hit
TACCCTGTAGATCCGGATTTGTG276210.1095842171431437No Hit
TAAGCTAACTCATACTAATTGCCCGAGAG268890.10668006280590824No Hit
CCCGTGTGAAAGTAGGTCATCGTCAGGCT262540.10416074859259603No Hit
ACCCTGTAGAACCGAATTTGT255440.10134387758243593No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC1080500.0198.7383723
GAGTGCC12350.0163.3645223
GTATGCC25750.0149.975923
TCGTATG1103650.0136.88522
GAGCACC41750.0135.2112423
ATCGCCC5350.0129.5133823
AGAGTGC13300.0121.6407922
GGCTCCC19050.0120.88515523
AGGCTCC16500.0120.6099922
TATCCCC850.0119.878323
CCGAGAG45750.0117.5986523
AGCGCTA1850.0115.6663523
AGAGCCC16650.0107.9150222
GCGCACT2550.0107.8904723
CTCGTAT1081900.0107.2778121
GCGCACC7950.099.97397623
GAGCCCC15350.094.262623
CCCGAGA74600.091.1606122
TAGCGCG1450.087.3304421
TCTCGTA1080800.086.5016720