FastQCFastQC Report
Mon 19 Dec 2016
Pool3_Index1_ATCACG_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index1_ATCACG_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences32512915
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA16816365.17220925899754RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGC10214513.1416776994618907RNA PCR Primer, Index 1 (100% over 50bp)
GCACCGAAGCTGTGGACTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG6830472.10084823215636RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC5483701.6866220700297097RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3946101.2137023087594576RNA PCR Primer, Index 1 (100% over 28bp)
GCACCGAAGCTGTGGACTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC3702721.138845901697833RNA PCR Primer, Index 1 (100% over 31bp)
TGCACCGAAGCTGTGGACTTGCATGGAATTCTCGGGTGCCAAGGAACTCC2854880.8780756816175971RNA PCR Primer, Index 1 (100% over 27bp)
GCACCGAAGCTGTGGACTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA2784790.8565180944249385RNA PCR Primer, Index 1 (100% over 32bp)
TGCACCGAAGCTGTGGACTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA1732520.5328713220577115RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA1704490.5242501326011525RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA1624270.49957686045683697RNA PCR Primer, Index 1 (100% over 28bp)
ATGCACCGAAGCTGTGGACTTGCATGGAATTCTCGGGTGCCAAGGAACTC1280450.3938281141509459RNA PCR Primer, Index 1 (100% over 26bp)
GCACCGAAGCTGTGGACTTGCATGGAATTCTCGGGTGCCAAGGAACTCCA1149270.3534810705222832RNA PCR Primer, Index 1 (100% over 28bp)
TGGTGACACGTTAAGCTAACTCATACTAATTGCCCGAGAGTGGAATTCTC999900.30753932706433734No Hit
TAAGTGCTAACTGTTGGGGTAGTGGAATTCTCGGGTGCCAAGGAACTCCA955890.29400316766429585RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA896650.27578271588382647RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC819310.2519952455816404RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA736300.2264638529027619RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC693370.21325986919351897RNA PCR Primer, Index 1 (100% over 27bp)
CAGAAGACTGCAGAGATGCTGGAATTCTCGGGTGCCAAGGAACTCCAGTC668260.20553678438245232RNA PCR Primer, Index 1 (100% over 31bp)
ATGCACCGAAGCTGTGGACTTGCTGGAATTCTCGGGTGCCAAGGAACTCC666600.2050262180428916RNA PCR Primer, Index 1 (100% over 27bp)
CAATGGCACTGCCCGGTAGCTACGTTCGGAACTGGAATTCTCGGGTGCCA580560.1785628880092726No Hit
TGGTGACACGTTAAGCTAACTCATACTAATTGCCCGAGATGGAATTCTCG568240.1747736245734964No Hit
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC530940.16330126043758303RNA PCR Primer, Index 1 (100% over 27bp)
GTAAACGGCGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCA486300.14957133188457572RNA PCR Primer, Index 1 (100% over 37bp)
ATTGATCGGTTTAGAAATAGACTGGAATTCTCGGGTGCCAAGGAACTCCA407970.12547936719915762RNA PCR Primer, Index 1 (100% over 28bp)
CATGCACCGAAGCTGTGGACTTGCATGGAATTCTCGGGTGCCAAGGAACT407400.12530405225123617RNA PCR Primer, Index 1 (100% over 25bp)
AGTAAACGGCGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATC399910.1230003523215313RNA PCR Primer, Index 1 (100% over 36bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC387220.11909728795464819RNA PCR Primer, Index 1 (100% over 27bp)
TCAAGTTGGCACTGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATC362500.11149415547636993RNA PCR Primer, Index 1 (100% over 36bp)
ATTAAGTAGACCGCCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA334830.10298369125007709RNA PCR Primer, Index 1 (100% over 34bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACCCTG3305150.043.1819231
TTGTCCC128400.043.174929
TATTGCA143000.042.9641151
CTTGTCC129350.042.8578268
ACTTGTC149250.042.538097
ATTTGTT1870350.042.4824517
CAACGCT67750.042.308847
TTTGTTG1880600.042.1563418
ATGTGTT431150.042.00745817
GTGCTAT30200.041.957694
TAAGTGC258850.041.84721
TGTCCCG135900.041.8281910
CGTATGC1121100.041.75352544
TCTCGTA1125300.041.5487541
CTCGTAT1126550.041.51046442
GTTTCCG23650.041.4349251
GCTTATC47750.041.422453
TGCTATT30500.041.4007385
AGTGCTA245600.041.3331683
ATCTCGT1130900.041.32531440