FastQCFastQC Report
Tue 20 Dec 2016
Pool3_Index3_TTAGGC_L007_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index3_TTAGGC_L007_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6315990
Sequences flagged as poor quality0
Sequence length15-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACTTAGGCATCTCGTATGC90032814.25474074531467Illumina PCR Primer Index 3 (100% over 29bp)
TACCCTGTAGAACCGAATTTGT3008244.762895444736296No Hit
TACCCTGTAGAACCGAATTTGCG2565884.062514348502769No Hit
AACTCCAGTCACTTA2308763.6554206070623922Illumina PCR Primer Index 3 (100% over 15bp)
AACTCCAGTCACTTAG2075713.286436488974808Illumina PCR Primer Index 3 (100% over 16bp)
AACTCCAGTCACTTAGG1891502.9947799157376753Illumina PCR Primer Index 3 (100% over 17bp)
AACTCCAGTCACTTAGGC1722162.72666676166365Illumina PCR Primer Index 3 (100% over 18bp)
AACTCCAGTCACTTAGGCA1514262.397502212638082Illumina PCR Primer Index 3 (100% over 19bp)
TAAGTGCTAACTGTTGGGGTAG1417392.244129582219098No Hit
AACTCCAGTCACTTAGGCAT1268052.007682089426994No Hit
ACCCTGTAGAACCGAATTTGCG960911.5213925291205337No Hit
AACTCCAGTCACTTAGGCATC934361.4793563637687837Illumina PCR Primer Index 3 (100% over 21bp)
AACTCCAGTCACTTAGGCATCT640741.0144727904889022Illumina PCR Primer Index 3 (100% over 22bp)
TACCCTGTAGAACCGAATGTGT640081.0134278236665986No Hit
TAAGTGCTATTTGTTGGGGAAG389830.6172112368765625No Hit
TAGCTTATCAGACTGGTGTTGGC347660.5504441900636321No Hit
GAATACCAGGTGCTGTAAGCTT339510.5375404330912494No Hit
AACTCCAGTCACTTAGGCATCTC329940.5223884141678502Illumina PCR Primer Index 3 (100% over 23bp)
TATTGCACTTGTCCCGGCCTGT288580.4569038266368376No Hit
TAAGTGCTAACTGTTGGGGTAT233830.370219078877579No Hit
TACCCTGTAGAACCGAATGTGTG229170.36284097979889135No Hit
ACCCTGTAGAACCGAATTTGTGT225100.35639701772802046No Hit
TACCCTGTAGAACCGAATTTGC196970.3118592651349986No Hit
TAAGTGCTACATGTTGGAGTC190780.3020587429682441No Hit
TAAGTGCTTCTCTTTGGGGTTG186250.294886470687889No Hit
ACCCTGTAGAACCGAATTTGTG185630.29390483518814947No Hit
TGGACAACTCTTAGCGG161890.2563176952465092No Hit
TACCCTGTAGAACCGAATTTGTG128790.20391102582493006No Hit
AAGTGCTAACTGTTGGGGTAG123360.1953137987868885No Hit
TACCAGGTGCTGTAAGCTT117840.18657407627307834No Hit
TAAGTGCTAACTGTTGGGGTA113110.17908514737990402No Hit
TCCCGGATTGTGCAC109480.17333782985723536No Hit
TAAGTGCTACATGTTGGGGTC105460.16697303193956925No Hit
CAAGTGCTTCTCTTTGGGGTTG103010.16309398843253395No Hit
TAAGTGCTACATGTTGGGGC95840.15174184886296527No Hit
GGAATACCAGGTGCTGTAAGCTT94320.14933525860553926No Hit
AACTCCAGTCACTTAGGCATCTCG87470.13848976961648135Illumina PCR Primer Index 3 (100% over 24bp)
TCCTTCATTCCACCGGAGTCTG86920.1376189639312285No Hit
ATACCAGGTGCTGTAAGCTT83540.13226746717458387No Hit
AAGCTGCCAGCTGAAGAACTGT81180.12853091914331718No Hit
TCGACTCCGTCTCTGGGCACC78620.12447771449923131No Hit
ACCCTGTAGAACCGAATGTGTG77480.12267277180616182No Hit
AATACCAGGTGCTGTAAGCTT72540.11485135346952734No Hit
TGAAATGTTTAGGACCACTTG67010.1060957981250762No Hit
TAAGTGCTAACTGTTGGGGT64720.10247007990829625No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC922350.091.2733923
TCGTATG925600.078.1883822
CGTATCC200.002303734269.38788623
CTCGTAT922000.068.8594321
CTTTATC650.067.2676922
GAGCACC12000.067.0749623
AGAAGCC7000.066.74454523
TCTCGTA920800.062.17936720
GTATGCC11600.058.620823
GGTACAC750.058.29866422
GCGCACT801.8189894E-1257.8232423
ATCTCGT921950.056.8298119
TAGGCCC303.138731E-452.99878722
GAGAAGC8800.052.39652622
CATCTCG925300.051.81613518
CGATAAC5100.051.23684320
TACTTCC807.2759576E-1249.6863622
GTCTTTA1450.047.76712420
TTAGAGC15250.047.06948520
TAACTGC1100.046.25859523