FastQCFastQC Report
Mon 19 Dec 2016
Pool3_Index3_TTAGGC_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index3_TTAGGC_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7725748
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGCATCTCGTATGC88988611.518444557083663RNA PCR Primer, Index 3 (100% over 50bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2949943.8183228342420694RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC2512673.2523323307982603RNA PCR Primer, Index 1 (100% over 27bp)
TAAGTGCTAACTGTTGGGGTAGTGGAATTCTCGGGTGCCAAGGAACTCCA1389601.798660789867855RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA941941.2192217504376275RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA627420.8121155388449118RNA PCR Primer, Index 1 (100% over 28bp)
GAGGTCGGCAGTTCAATCCTGCCCATGGGCACCATGGAATTCTCGGGTGC484430.6270331364678217No Hit
TAAGTGCTATTTGTTGGGGAAGTGGAATTCTCGGGTGCCAAGGAACTCCA382180.4946834921356482RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC340500.44073402342401025RNA PCR Primer, Index 1 (100% over 27bp)
GAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCA332720.4306638010973177RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA289360.374539785662178No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA282870.3661393045696028RNA PCR Primer, Index 1 (100% over 28bp)
CAGTAATGCATTAAGCTAACCAGTACTAATTGCCCGTGCGGCTTGACTGG275130.3561208571648985No Hit
TAAGTGCTAACTGTTGGGGTATTGGAATTCTCGGGTGCCAAGGAACTCCA229790.297433983091346RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC224540.29063852458040307RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC220550.28547397611208647RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA192650.24936096802536142RNA PCR Primer, Index 1 (100% over 28bp)
TAAGTGCTACATGTTGGAGTCTGGAATTCTCGGGTGCCAAGGAACTCCAG186430.24130996765620621RNA PCR Primer, Index 1 (100% over 29bp)
TAAGTGCTTCTCTTTGGGGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA182820.2366372809467769RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA182240.23588654457794897RNA PCR Primer, Index 1 (100% over 28bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC157610.20400613636375403RNA PCR Primer, Index 1 (100% over 33bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC140870.182338331511719No Hit
CCCGGATTGTGCACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTA132460.17145265416371333RNA PCR Primer, Index 3 (100% over 36bp)
GCATTGGTGGTCCAGTGGTAGGATTCTCGCCTTGGAATTCTCGGGTGCCA127210.16465719565277045No Hit
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC126200.16334987887257002RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC124400.16102000738310387No Hit
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT124310.16090351380863055No Hit
AAGTGCTAACTGTTGGGGTAGTGGAATTCTCGGGTGCCAAGGAACTCCAG120360.1557907402623021RNA PCR Primer, Index 1 (100% over 29bp)
AGTAAACGGCGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTA117250.15176524007772452RNA PCR Primer, Index 3 (100% over 36bp)
TACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC114810.1486069698364482RNA PCR Primer, Index 1 (100% over 31bp)
TAAGTGCTAACTGTTGGGGTATGGAATTCTCGGGTGCCAAGGAACTCCAG110280.14274345992129175RNA PCR Primer, Index 1 (100% over 29bp)
TCCCGGATTGTGCACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTT106380.13769540502744848RNA PCR Primer, Index 1 (97% over 35bp)
TAAGTGCTACATGTTGGGGTCTGGAATTCTCGGGTGCCAAGGAACTCCAG103530.13400644183579377RNA PCR Primer, Index 1 (100% over 29bp)
CAAGTGCTTCTCTTTGGGGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA101180.13096466516899075RNA PCR Primer, Index 1 (100% over 28bp)
TAAGTGCTACATGTTGGGGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT93150.1205708495798724RNA PCR Primer, Index 1 (100% over 30bp)
GGAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC92750.12005310035999105RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA92480.11970361963657111No Hit
GTAAACGGCGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAG86650.11215742475680025RNA PCR Primer, Index 3 (100% over 37bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA85300.11041002113970065RNA PCR Primer, Index 1 (100% over 28bp)
ATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT81890.10599620904021202RNA PCR Primer, Index 1 (100% over 30bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA79590.10301915102589418RNA PCR Primer, Index 1 (100% over 28bp)
TAAGGGAGAGGTCGGCAGTTCAATCCTGCCCATGGGCACCTGGAATTCTC78580.10171183424569376No Hit
AAGGGAGAGGTCGGCAGTTCAATCCTGCCCATGGGCACCATGGAATTCTC78320.10137529725277086No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTGCTAT50550.043.7792634
CTATTTG50600.043.5621037
GCTATTT50550.043.5616726
TACCCTG721900.043.5557941
TGCTATT50550.043.5181545
GCTTATC35200.043.4405823
TTGTCCC41000.043.4066549
TAAGTGC345050.043.3418431
TATTTGT51250.043.0096058
CTTATCA35650.043.009554
CATTGGT65000.042.8952
CTTGTCC41500.042.8836828
TGTCCCG41800.042.83904310
CGTATGC931650.042.7556844
TTATCAG35900.042.710045
TATTGCA43700.042.632871
CATTAAG29400.042.5751889
AATGCAT29300.042.5703355
TCTCGTA935400.042.5207741
CTCGTAT936700.042.45705842