FastQCFastQC Report
Tue 20 Dec 2016
Pool3_Index4_TGACCA_L007_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index4_TGACCA_L007_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11719465
Sequences flagged as poor quality0
Sequence length15-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGT7715856.583790301007768No Hit
AACTCCAGTCACTGACCAATCTCGTATGC6250905.333775901886306Illumina PCR Primer Index 4 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCG4829394.120828041211779No Hit
AACTCCAGTCACTGA4634113.9541992744549344Illumina PCR Primer Index 4 (100% over 15bp)
AACTCCAGTCACTGAC4537023.8713541957760014Illumina PCR Primer Index 4 (100% over 16bp)
AACTCCAGTCACTGACC4293683.6637167310965135Illumina PCR Primer Index 4 (100% over 17bp)
AACTCCAGTCACTGACCA4140843.533301221514805Illumina PCR Primer Index 4 (100% over 18bp)
AACTCCAGTCACTGACCAA3893593.322327427062584Illumina PCR Primer Index 4 (100% over 19bp)
AACTCCAGTCACTGACCAAT3340992.8508041962666386No Hit
AACTCCAGTCACTGACCAATC2588032.208317529853112Illumina PCR Primer Index 4 (100% over 21bp)
AACTCCAGTCACTGACCAATCT1866881.5929737406955011Illumina PCR Primer Index 4 (100% over 22bp)
ACCCTGTAGAACCGAATTTGCG1692511.444187085331967No Hit
TACCCTGTAGAACCGAATGTGT1682621.435748133553878No Hit
TAAGTGCTAACTGTTGGGGTAG1626001.3874353479446373No Hit
AACTCCAGTCACTGACCAATCTC939030.8012567126571051Illumina PCR Primer Index 4 (100% over 23bp)
TATTGCACTTGTCCCGGCCTGT637450.5439241467080622No Hit
TACCCTGTAGAACCGAATGTGTG610200.5206722320515484No Hit
GAATACCAGGTGCTGTAAGCTT608590.5192984492039526No Hit
TAGCTTATCAGACTGGTGTTGGC589600.5030946378524959No Hit
ACCCTGTAGAACCGAATTTGTGT581490.4961745267382086No Hit
ACCCTGTAGAACCGAATTTGTG498570.4254204436806629No Hit
TACCCTGTAGAACCGAATTTGC461590.3938661022495481No Hit
TAAGTGCTATTTGTTGGGGAAG394270.33642320703206163No Hit
TACCAGGTGCTGTAAGCTT393590.33584297576723854No Hit
TACCCTGTAGAACCGAATTTGTG333010.28415119632167507No Hit
TAAGTGCTAACTGTTGGGGTAT322260.27497842264983935No Hit
ATACCAGGTGCTGTAAGCTT234810.2003589754310457No Hit
ACCCTGTAGAACCGAATGTGTG228340.1948382456025083No Hit
AACTCCAGTCACTGACCAATCTCG221020.18859222669294204Illumina PCR Primer Index 4 (100% over 24bp)
TAAGTGCTTCTCTTTGGGGTTG204030.17409497788508263No Hit
TAAGTGCTACATGTTGGAGTC203400.17355741068384947No Hit
ATCCATGATCACAAGACT196900.16801108241715812No Hit
GCACCGAAGCTGTGGACTTGC189640.16181626038389976No Hit
TCCTTCATTCCACCGGAGTCTG182970.15612487430100264No Hit
TGGACAACTCTTAGCGG168590.14385468961253778No Hit
AATACCAGGTGCTGTAAGCTT161040.13741241601045784No Hit
GCACCGAAGCTGTGGACTT155500.13268523776469318No Hit
TACCCTGTAGATCCGGATTTGTG150750.1286321517236495No Hit
TACCAGGTGCTGTAAGCT150640.12853829078375165No Hit
GGGTCTGTAGCTCAGCTGGTTAGAGCACC147670.12600404540650958No Hit
CCCGTGTGAAAGTAGGTCATCGTCAGGCT147060.1254835438307124No Hit
CTGGGATAATAGAACGGAATGGAAAGTCC145900.12449373755542596No Hit
TAAGTGCTAACTGTTGGGGTA144350.12317115158413802No Hit
GGAATACCAGGTGCTGTAAGCTT136110.11614011390451698No Hit
AAGCTGCCAGCTGAAGAACTGT135510.11562814514143778No Hit
GGGTCTGTAGCTCAGTCGGTTAGAGCACC132280.11287204663352807No Hit
AAGTGCTAACTGTTGGGGTAG130810.11161772316398402No Hit
AACATTCAACGCTGTCGGTGAGT129570.11055965438695368No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC665650.0177.8817923
GAGCACC40550.0152.1573223
GTATGCC16400.0146.9254823
TCGTATG669850.0136.3590122
TACTTCC3500.0124.5496422
CTCGTAT666900.0111.23031621
CTTTATC2000.0108.98093422
TCTCGTA664800.094.6948620
TCTTTAT1950.093.783121
GCGCACT1850.093.73868623
TAACTGC3300.091.2718823
AGAGCAC56350.089.8374522
AGAAGCC7300.088.77128623
TTACTTC4600.088.2083621
AAAGTCC36650.086.41566523
GGTACAC1100.083.0939722
GTCTTTA2700.082.6170920
ATCTCGT669400.082.3090819
GTTACTT4800.080.8210620
CGTGTGC801.3078534E-979.8628923