FastQCFastQC Report
Mon 19 Dec 2016
Pool3_Index4_TGACCA_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index4_TGACCA_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14722676
Sequences flagged as poor quality0
Sequence length50
%GC53

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA7528225.113350317564551RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGC6164764.187255088680889RNA PCR Primer, Index 4 (100% over 50bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC4698773.191518987444945RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA1652261.1222552204504128RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1641511.114953558714462RNA PCR Primer, Index 1 (100% over 28bp)
TAAGTGCTAACTGTTGGGGTAGTGGAATTCTCGGGTGCCAAGGAACTCCA1589611.0797018150776394RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1172550.7964245086966528No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC1019240.6922926239767825No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC645530.4384596930612343No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA621980.4224639596768957RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC620870.4217100206511371No Hit
GAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCA594820.4040162263979728RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC594260.4036358607633557RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC574240.3900377893257992RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC567600.38552773965819803RNA PCR Primer, Index 1 (100% over 27bp)
GAGGTCGGCAGTTCAATCCTGCCCATGGGCACCATGGAATTCTCGGGTGC520600.35360419532427395No Hit
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA487050.3308162184646324RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA449400.3052434217801166RNA PCR Primer, Index 1 (100% over 28bp)
TAAGTGCTATTTGTTGGGGAAGTGGAATTCTCGGGTGCCAAGGAACTCCA385160.26161004969477014RNA PCR Primer, Index 1 (100% over 28bp)
TACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC379130.2575143268791625RNA PCR Primer, Index 1 (100% over 31bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC330620.22456515378046762No Hit
CAGTAATGCATTAAGCTAACCAGTACTAATTGCCCGTGCGGCTTGACTGG325350.22098564146898295No Hit
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC324600.22047622320833524RNA PCR Primer, Index 1 (100% over 27bp)
TAAGTGCTAACTGTTGGGGTATTGGAATTCTCGGGTGCCAAGGAACTCCA314940.21391491601119253RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA291550.19802785852245883No Hit
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC253610.17225808677715926No Hit
GCATTGGTGGTCCAGTGGTAGGATTCTCGCCTTGGAATTCTCGGGTGCCA231900.15751212619227645No Hit
ATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT227090.1542450570806557RNA PCR Primer, Index 1 (100% over 30bp)
ACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA222680.1512496777080471RNA PCR Primer, Index 1 (100% over 28bp)
TAAGTGCTTCTCTTTGGGGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA199440.13546450387144293RNA PCR Primer, Index 1 (100% over 28bp)
TAAGTGCTACATGTTGGAGTCTGGAATTCTCGGGTGCCAAGGAACTCCAG197180.13392945684602445RNA PCR Primer, Index 1 (100% over 29bp)
ATCCATGATCACAAGACTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA190410.12933110801324432RNA PCR Primer, Index 1 (100% over 32bp)
GCACCGAAGCTGTGGACTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG182930.12425050989371769RNA PCR Primer, Index 1 (100% over 29bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA178620.1213230529558621RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCTGGAATTCTCGGGTGCCAAG173490.11783863205303167No Hit
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT164360.11163731376008003No Hit
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC162530.11039433320409958RNA PCR Primer, Index 1 (100% over 33bp)
AGTAAACGGCGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGA161190.10948417257840898RNA PCR Primer, Index 2 (97% over 36bp)
GTAAACGGCGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGAC160000.10867589560484793RNA PCR Primer, Index 4 (100% over 37bp)
AATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAG155900.1058910757799737RNA PCR Primer, Index 1 (100% over 29bp)
GCACCGAAGCTGTGGACTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC149820.10176139174698946RNA PCR Primer, Index 1 (100% over 31bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCTTATC61550.043.6818283
TACCCTG1676500.043.6728671
GTTTCCG101400.043.3241
CATTGGT229550.043.3085632
TGCTATT54850.043.235095
TATTGCA95500.043.049151
TTGTCCC89800.043.0172279
TAAGTGC404050.043.016061
GTGCTAT55450.042.9656224
CTTGTCC90100.042.849588
CTTATCA62850.042.807064
ATTGGTG233500.042.6278463
TGCACTT103850.042.5990374
ACTTGTC104250.042.435597
ATTGCAC110150.042.4102022
CAGTAAT40250.042.3993761
TGGTGGT429900.042.3954545
GCTATTT56100.042.3501666
CTATTTG56200.042.274817
GGTGGTC228650.042.1691136