FastQCFastQC Report
Wed 21 Dec 2016
Pool3_Index5_ACAGTG_L007_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index5_ACAGTG_L007_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences23300190
Sequences flagged as poor quality0
Sequence length15-29
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGT10807504.63837419351516No Hit
CCGTGTGAAAGTAGGACATCGTCAGGCT7918113.3983027606212657No Hit
AACTCCAGTCACACA7771363.3353204415929656Illumina PCR Primer Index 5 (100% over 15bp)
AACTCCAGTCACACAG5662442.4302119424777224Illumina PCR Primer Index 5 (100% over 16bp)
AACTCCAGTCACACAGT4506371.934048606470591Illumina PCR Primer Index 5 (100% over 17bp)
TACCCTGTAGAACCGAATTTGCG3718561.5959354837879005No Hit
AACTCCAGTCACACAGTG3554851.5256742541584425Illumina PCR Primer Index 5 (100% over 18bp)
AACTCCAGTCACACAGTGA2898241.2438696851828248Illumina PCR Primer Index 5 (100% over 19bp)
TACCCTGTAGAACCGAATGTGT2405741.0324980182565036No Hit
CCCGTGTGAAAGTAGGACATCGTCAGGCT2362441.0139144788089711No Hit
AACTCCAGTCACACAGTGAT2171980.9321726561028042No Hit
AGGACATCGTCAGGCT2094700.8990055445899796No Hit
CTTTTGTTACGGACGATCTCGCATCAGA1434110.6154928350369675No Hit
AACTCCAGTCACACAGTGATC1389190.5962140222890887Illumina PCR Primer Index 5 (100% over 21bp)
ACCCTGTAGAACCGAATTTGCG1200980.5154378569445142No Hit
AACTCCAGTCACACAGTGATCTCGTATGC1034450.44396633675519387Illumina PCR Primer Index 5 (100% over 29bp)
TACCCTGTAGAACCGAATTTGC959500.4117992170879293No Hit
CGGTGCGGAGAGCCGTTCGTGACT916300.3932585957453566No Hit
TAAGTGCTAACTGTTGGGGTAG881260.37822009176749205No Hit
AACTCCAGTCACACAGTGATCT840260.3606236687340318Illumina PCR Primer Index 5 (100% over 22bp)
GGGTCTGTAGCTCAGTCGGTTAGAGCACC816140.350271821817762No Hit
ATTTGGTTGGGCACTCTAATGAGACTGCC766380.32891577278983564No Hit
TCAGGCGCTTGAGAGAACTCTGGAGA720150.3090747328669852No Hit
CTCAGGCGCTTGAGAGAACTCTGGAGA716040.3073107987531432No Hit
GCGAAATCGGAACAGCCT667110.286310969996382No Hit
GCGCTTGAGAGAACTCTGGAGA659930.2832294500602785No Hit
ACCCTGTAGAACCGAATTTGTGT540780.23209252800084462No Hit
AGGCGCTTGAGAGAACTCTGGAGA488380.20960344100198325No Hit
CGGTGCGGAGAGCCGTTCGTGAC468870.20123011872435376No Hit
CGTTTTAGCAGTTGGTTTATCAGAACGGA465860.19993828376506803No Hit
AACTCCAGTCACACAGTGATCTC438260.1880928867962021Illumina PCR Primer Index 5 (100% over 23bp)
AGGCGCTTGAGAGAACTCTGGAGAAGG435900.18708001951915412No Hit
GGACATCGTCAGGCT409410.17571101351534044No Hit
TATTGCACTTGTCCCGGCCTGT396930.17035483401637497No Hit
TTACGGCAATTCTGGGGTTGTAGGACCA389790.16729048132225532No Hit
ACCCTGTAGAACCGAATTTGTG355780.15269403382547525No Hit
TACCCTGTAGAACCGAATGTGTG333160.14298595848360035No Hit
AATTCTGGGGTTGTAGGACCA329700.14150099205199615No Hit
ATACCGAAGCTGCGGACTTGC323830.13898169929086415No Hit
TCAATGCTGAGAACTGATGACGAGTGT311850.133840110316697No Hit
GGCGCTTGAGAGAACTCTGGAGA298480.12810195968359056No Hit
CTAATGCTGAGATACGAGACGAGCC287580.12342388624298772No Hit
CTACCGAAGCTATGGATTTACG276800.11879731452833647No Hit
CAGGCGCTTGAGAGAACTCTGGAGA266350.11431237256005208No Hit
TTACCGAAGCTGCGGATTTGCT261250.11212354920710947No Hit
GTTTTTTGTTGTCCGGTCC251590.1079776602680064No Hit
CGAAATCGGAACAGCCT246430.10576308605208799No Hit
CTCGGGGGCCTGAGTCCT239260.10268585792648044No Hit
CGCTTGAGAGAACTCTGGAGA237800.10205925359406941No Hit
TGTGTTAGTGGAATGCTCTGGAAAGTGC237190.10179745315381548No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC111000.0200.0397223
GAGCACC119150.0176.9198523
GTAGCAG12800.0142.8495823
ACAAACC25700.0142.7026423
GCGCACT15700.0133.196623
ATGGGGA26300.0122.2659123
GAGTACT13950.0118.2674223
GTATGCC4400.0112.2496123
GAGCGCT27050.0105.6674723
GAACGGA127650.0105.6198423
ACTCGCC14200.0100.6445523
GACTGCC212750.098.589523
GCGCACC12800.093.591123
CTTCTAA3150.093.4086723
GAGTGCC8550.092.179623
CATCAGA147950.088.895922
TCGTATG119300.083.5767522
AAAGTGC94650.080.04870623
AGCGCCT21500.072.8261723
GCATCAG146100.069.7005721