FastQCFastQC Report
Mon 19 Dec 2016
Pool3_Index5_ACAGTG_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenamePool3_Index5_ACAGTG_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences36800770
Sequences flagged as poor quality0
Sequence length50
%GC53

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA10533882.8624074985387535RNA PCR Primer, Index 1 (100% over 28bp)
CCGTGTGAAAGTAGGACATCGTCAGGCTTGGAATTCTCGGGTGCCAAGGA7789082.116553539504744RNA PCR Primer, Index 1 (100% over 22bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC3613040.9817838050671223RNA PCR Primer, Index 1 (100% over 27bp)
AGGACGTGATAGCCTGCGATAAGCTTCGGGGAGCTGGCATGGAATTCTCG3147050.8551587371677277No Hit
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2344680.6371279731375186RNA PCR Primer, Index 1 (100% over 28bp)
CCCGTGTGAAAGTAGGACATCGTCAGGCTTGGAATTCTCGGGTGCCAAGG2324560.6316606962299974Illumina Small RNA Adapter 2 (100% over 21bp)
GAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATGGAAT2036010.5532520107595574No Hit
AGGACATCGTCAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA2015880.5477820165175892RNA PCR Primer, Index 1 (100% over 34bp)
ATCCGTTGGTCGTAGGTTCGAATCCTACAGGGCCCTGGAATTCTCGGGTG1442080.39186136594424514No Hit
GAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGATGGAATT1409500.38300829031566463No Hit
CTTTTGTTACGGACGATCTCGCATCAGATGGAATTCTCGGGTGCCAAGGA1409050.3828860102655461RNA PCR Primer, Index 1 (100% over 22bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA1171210.3182569277762395RNA PCR Primer, Index 1 (100% over 28bp)
GAACGCTGTTGGTCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACA1085010.2948335048424258RNA PCR Primer, Index 5 (100% over 36bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC1019830.2771219189163705RNA PCR Primer, Index 5 (100% over 50bp)
AGTCATGTCGGGAACTCTAACGAGACTGCCATGGAATTCTCGGGTGCCAA953970.2592255542479138No Hit
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA934120.2538316453704637RNA PCR Primer, Index 1 (100% over 28bp)
CGGTGCGGAGAGCCGTTCGTGACTTGGAATTCTCGGGTGCCAAGGAACTC895680.2433862117558953RNA PCR Primer, Index 1 (100% over 26bp)
TAAGTGCTAACTGTTGGGGTAGTGGAATTCTCGGGTGCCAAGGAACTCCA859980.23368532777982634RNA PCR Primer, Index 1 (100% over 28bp)
TGAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATGGAA821530.2232371768308109No Hit
TCTGCAAAATCGTAAGATGAAGTATAGGGCCTGACACTGGAATTCTCGGG812420.22076168514952266No Hit
GGGTCTGTAGCTCAGTCGGTTAGAGCACCTGGAATTCTCGGGTGCCAAGG804650.21865031628414297Illumina Small RNA Adapter 2 (100% over 21bp)
ATTTGGTTGGGCACTCTAATGAGACTGCCTGGAATTCTCGGGTGCCAAGG755110.20518864143331783Illumina Small RNA Adapter 2 (100% over 21bp)
TCAGGCGCTTGAGAGAACTCTGGAGATGGAATTCTCGGGTGCCAAGGAAC705330.19166175055576284RNA PCR Primer, Index 1 (100% over 24bp)
CTCAGGCGCTTGAGAGAACTCTGGAGATGGAATTCTCGGGTGCCAAGGAA703630.19119980369975953RNA PCR Primer, Index 1 (100% over 23bp)
TCCGTTGGTCGTAGGTTCGAATCCTACAGGGCCCTGGAATTCTCGGGTGC690920.1877460716175232No Hit
GAATTGATCCGTAGATATCCGAATGGGGCAACCCACTATTGGAATTCTCG654590.17787399557128833No Hit
GCGGCTGTAGCTCAGTTGGATAGAGTACTTGGCTGGAATTCTCGGGTGCC648780.17629522425753594No Hit
GCGCTTGAGAGAACTCTGGAGATGGAATTCTCGGGTGCCAAGGAACTCCA644580.1751539437897631RNA PCR Primer, Index 1 (100% over 28bp)
GCGAAATCGGAACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA643210.1747816689705134RNA PCR Primer, Index 1 (100% over 32bp)
AGTCATGTCGGGAACTCTAACAAGACTGCCATGGAATTCTCGGGTGCCAA538810.14641269734301754No Hit
ACCCTGTAGAACCGAATTTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC527110.14323341603993614RNA PCR Primer, Index 1 (100% over 27bp)
AGGGAAGAAATCTTTTGAGCTAATACCTCGGAATGGAATTCTCGGGTGCC523340.14220898095338766No Hit
GAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATTCTCG502910.13665746667800702No Hit
AGGCGCTTGAGAGAACTCTGGAGATGGAATTCTCGGGTGCCAAGGAACTC477810.12983695721584088RNA PCR Primer, Index 1 (100% over 26bp)
CTGAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATGGA470920.12796471378180402No Hit
CGTTTTAGCAGTTGGTTTATCAGAACGGATGGAATTCTCGGGTGCCAAGG457770.12439141898389625Illumina Small RNA Adapter 2 (100% over 21bp)
CGGTGCGGAGAGCCGTTCGTGACTGGAATTCTCGGGTGCCAAGGAACTCC456980.12417674956257709RNA PCR Primer, Index 1 (100% over 27bp)
AGTAATGTCATAGTCGAGTAGTACTAATAACCCTGGAATTCTCGGGTGCC435200.11825839513684089No Hit
AGGCGCTTGAGAGAACTCTGGAGAAGGTGGAATTCTCGGGTGCCAAGGAA425660.11566605807432834RNA PCR Primer, Index 1 (100% over 23bp)
GGACATCGTCAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC391150.10628853689746166RNA PCR Primer, Index 5 (100% over 35bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA386440.10500867237288784RNA PCR Primer, Index 1 (100% over 28bp)
TTACGGCAATTCTGGGGTTGTAGGACCATGGAATTCTCGGGTGCCAAGGA384110.10437553344671863RNA PCR Primer, Index 1 (100% over 22bp)
TTGTTTGGCGTGTAGAGGGTCACATGGAAGCTTCTCTCTGGAATTCTCGG379110.10301686622317956No Hit

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACCCTG2027900.042.881951
CTCGCAT153950.042.66858318
TATTGCA72650.041.8874931
TTGTCCC71050.041.5201849
ATCTCGC158300.041.48178516
TCTCGCA158800.041.3788817
CGCATCA158750.041.35157420
TTTGTTA159300.041.322093
AGTGCTA233650.041.223653
ATTTGTT1204350.041.12021617
ATGTGTT265300.040.80468817
GTGCTAT30600.040.690124
CGTTTTA69400.040.6127551
TCCCATA41700.040.39591
TCGCATC163050.040.31451419
GCATCAG162950.040.31274821
CTTGTCC73250.040.153038
ATACCTC63450.040.0151323
GTATCTC52850.040.00119414
TGTCCCG94350.039.80028510