FastQCFastQC Report
Wed 21 Dec 2016
S_No_37_ACAGTG_L001_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameS_No_37_ACAGTG_L001_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13889053
Sequences flagged as poor quality0
Sequence length15-29
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATACCGAAGCTGCGGACTTGC2302451.6577444120920266No Hit
TACCCTGTAGAACCGAATTTGT1445351.04063970380126No Hit
TACCCTGTAGAACCGAATTTGCG1158930.8344197404963463No Hit
GCACCGAAGCTGTGGACTTGC1131130.8144039770026078No Hit
AACTCCAGTCACACA971830.6997093322345304Illumina PCR Primer Index 5 (100% over 15bp)
TTTGGTTGGGCACTCTAATGAGACTGCC754270.5430679831087115No Hit
AACTCCAGTCACACAG712490.5129867385486973Illumina PCR Primer Index 5 (100% over 16bp)
TGCACCGAAGCTGTGGACTTGCA679370.48914062031443034No Hit
ATTCGGTCGGGAACTCTAGGGAGACTGCC635620.45764099251403245No Hit
AACTCCAGTCACACAGT540070.38884580539796343Illumina PCR Primer Index 5 (100% over 17bp)
TGCACCGAAGCTGTGGACTTGC459190.3306128934780507No Hit
CCGTGTGAAAGTAGGACATCGTCAGGCT448760.3231033822104358No Hit
CGAGTTAGTGAAACGGTCTGGAAAGTCC447240.3220089951417134No Hit
GCACCGAAGCTGTGGACTT419760.3022236289256006No Hit
CTTCGGTTGGTCCCGGATAGCTGGCC401230.2888821865680835No Hit
CTCGGGCCGGTGCGGAGAGCCGTTCGTG389430.28038628695563333No Hit
CAATGCTGAGAACTGATGACGAGTGT382190.27517354854935033No Hit
AACTCCAGTCACACAGTG381020.27433115850303114Illumina PCR Primer Index 5 (100% over 18bp)
GGGTCTGTAGCTCAGTCGGTTAGAGCACC368080.26501446858903915No Hit
CTAATGCTGAGATACGAGACGAGCC362240.2608097182723689No Hit
AATGCTGAGAACTGATGACGAGTGT337380.24291072976681707No Hit
TAAGTGCTAACTGTTGGGGTAG334430.24078675486370452No Hit
TTCCATAGAAGGTGATAGGCCTGTAGCA326360.2349764235185797No Hit
TCAATGCTGAGAACTGATGACGAGTGT323930.23322684419160902No Hit
ACCCTGTAGAACCGAATTTGCG310480.22354295861640097No Hit
GTGTGAAAGTAGGACACCGCCAGACT280220.20175601605091437No Hit
ATGCACCGAAGCTGTGGACTTGCA266900.19216572936974177No Hit
GCTAAGGCTGAGAACTGATGACGAGTGT261810.1885009726725069No Hit
AACTCCAGTCACACAGTGA261690.18841457369339726Illumina PCR Primer Index 5 (100% over 19bp)
GAGGTGTAGAATAAGTGGGAGGCCT247760.17838509220175056No Hit
AATCTTCGGTTGGTCCCGGATAGCTGGCC233120.16784441675037168No Hit
CGGTGCGGAGAGCCGTTCGTGACT232020.1670524261085331No Hit
GCACCGAAGCTGTGGACT226040.16274687698290155No Hit
GCACCGAAGCTGTGGACTTGCA222520.16021250692901812No Hit
TATTGCACTTGTCCCGGCCTGT219470.15801653287664752No Hit
CCCGTGTGAAAGTAGGACATCGTCAGGCT217200.15638215218848975No Hit
TACCCTGTAGAACCGAATGTGTG206480.14866384338802652No Hit
CTCGGTTCTGGTGTCAAGCGCC204610.14731745929690093No Hit
TTGTGTTAGTGGAACGCTCTGGAAAGTGC201840.1453230828624529No Hit
AATTCTGGGGTTGTAGGACCA201420.1450206864355691No Hit
TACCCTGTAGAACCGAATGTGT200460.1443294946026918No Hit
CGGTGCGGAGAGCCGTTCGTGAC196050.14115433212041167No Hit
GTATTAGTGGAAGGCTCTGGAAAGTGC189000.13607839209771896No Hit
AGGTGTAGAATAAGTGGGAGGCCT184490.1328312304661808No Hit
AACTCCAGTCACACAGTGAT183700.1322624371870422No Hit
CTCGGTTCTGGTGTCAAGCGC180910.13025366092274254No Hit
ATCAATGCCGAGAACTGATGACGAGTGT176480.12706409861061083No Hit
TTGTGTTAGTGGAATGCTCTGGAAAGTGC175370.12626490805384644No Hit
TTACGGCAATTCTGGGGTTGTAGGACCA171850.123730537999963No Hit
ACCCTGTAGAACCGAATTTGTG165180.1189281947444509No Hit
GGCGTGCCCGCCGGGGTTGTAGGGCTGC161500.11627862605175457No Hit
GCGGCGACTCTGGACGCGCGCCGGGCC158860.114377848511342No Hit
ATAGTCGAGTAGTACTAATAACCC156820.11290906586647771No Hit
CGGGGTGTAGCTTAGCCTGGTAGAGCGCT153440.11047549462155555No Hit
TTCCATAGAAGGTGATAGGCCTGTAGCAG147250.10601874728248212No Hit
GTTAGTGGAATCTTCTGGAAAGTAGA142850.1028507847151278No Hit
TACCCTGTAGAACCGAATTTGTG142690.10273558607631493No Hit
CAATGCTGAGAACTGATGACGAGTGTC141910.1021739927121021No Hit
GGAATACCAGGTGCTGTAAGCTT140590.10122360394189582No Hit
CTCTCGGTTCTGGTGTCAAGCGC140050.10083480853590233No Hit
CTCTCGGTTCTGGTGTCAAGCGCC139190.10021561585228309No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC10700.0122.1016523
GAGCACC74650.0118.08710523
GTAGCAG17100.0116.2833623
GGCTCCC8350.0111.7611323
GCGCACT14650.0102.4100523
AGCGCTA1800.079.76115423
AGCGCTT3850.076.446423
GCGCACC16350.074.6388823
GAGCGCA16850.071.14599623
CCACTAT554.309033E-665.2591223
GAGTACT10500.064.94836423
GTTTGCC7250.064.3589923
GAGCGCT36800.063.7872523
TGTAGCA53450.063.0889222
AATTTCC4500.062.213723
TAATAGG6800.058.06142423
GGGCCCT9350.057.58157723
GAGTGCC8050.057.07133523
GACACCT16700.056.74026523
ATGTACC3050.056.48658423