FastQCFastQC Report
Mon 19 Dec 2016
S_No_37_ACAGTG_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameS_No_37_ACAGTG_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences33287472
Sequences flagged as poor quality0
Sequence length50
%GC53

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
ATACCGAAGCTGCGGACTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG2216350.6658210632516642RNA PCR Primer, Index 1 (100% over 29bp)
CGCGGGATGGAGCAGCCTGGTAGCTCGTCGGGCTCTGGAATTCTCGGGTG1995730.5995438764469707No Hit
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1398380.42009197934886733RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1120840.33671526633203025RNA PCR Primer, Index 1 (100% over 27bp)
GCACCGAAGCTGTGGACTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG1084550.3258132669251663RNA PCR Primer, Index 1 (100% over 29bp)
TATCGAATCGCCATCTAAAGAAATGGAGGCTCTGCTTCCCTCGACGGCGC1002360.30112229609986607No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC985800.2961474515096851No Hit
TGGTCTGTAGCTCAGGTGGTTAGAGCGCACCCCTTGGAATTCTCGGGTGC949010.2850952454424896No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGTGGAATTCTCG910620.27356237806223316No Hit
AGTCATGTCGGGAACTCTAACGAGACTGCCATGGAATTCTCGGGTGCCAA843620.25343468557780535No Hit
TGCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTCT795460.23896678005467042No Hit
TTTGGTTGGGCACTCTAATGAGACTGCCTGGAATTCTCGGGTGCCAAGGA741020.2226122788777712RNA PCR Primer, Index 1 (100% over 22bp)
TGCACCGAAGCTGTGGACTTGCATGGAATTCTCGGGTGCCAAGGAACTCC656520.19722735328173915RNA PCR Primer, Index 1 (100% over 27bp)
ATTCGGTCGGGAACTCTAGGGAGACTGCCTGGAATTCTCGGGTGCCAAGG626110.18809178420037426Illumina Small RNA Adapter 2 (100% over 21bp)
TACTTGGATAACTGTGGCAATTCTAGAGCTAATACATGCAAACTGGAATT477720.14351345154717665No Hit
TGCACCGAAGCTGTGGACTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA442610.13296593985869518RNA PCR Primer, Index 1 (100% over 28bp)
CGAGTTAGTGAAACGGTCTGGAAAGTCCTGGAATTCTCGGGTGCCAAGGA438890.13184840230582845RNA PCR Primer, Index 1 (100% over 22bp)
CCGTGTGAAAGTAGGACATCGTCAGGCTTGGAATTCTCGGGTGCCAAGGA437040.1312926376626017RNA PCR Primer, Index 1 (100% over 22bp)
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTGGAATTCTC428830.12882624429995765No Hit
TGGGCTGGGGTGCGGCCGAATGATGGCTGCTGGAATTCTCGGGTGCCAAG419400.12599334668610462No Hit
AGTCATGTCGGGAACTCTAACGAGACTGCCTGGAATTCTCGGGTGCCAAG416670.12517321832069436No Hit
GGTTAAGCTGAGGACTCTATTCCAACTGCCTTGGAATTCTCGGGTGCCAA414760.12459942887822784No Hit
AAATCTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAG407970.12255962243092537No Hit
GCACCGAAGCTGTGGACTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC404270.12144809314447189RNA PCR Primer, Index 1 (100% over 31bp)
AGTAATGTCATAGTCGAGTAGTACTAATAACCCTGGAATTCTCGGGTGCC397270.11934519989983017No Hit
CTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAGGAAC392040.11777403823276217RNA PCR Primer, Index 1 (100% over 24bp)
CTCGGGCCGGTGCGGAGAGCCGTTCGTGTGGAATTCTCGGGTGCCAAGGA380650.11435233051040944RNA PCR Primer, Index 1 (100% over 22bp)
CAATGCTGAGAACTGATGACGAGTGTTGGAATTCTCGGGTGCCAAGGAAC373280.11213828433712239RNA PCR Primer, Index 1 (100% over 24bp)
GGGTCTGTAGCTCAGTCGGTTAGAGCACCTGGAATTCTCGGGTGCCAAGG363330.10914917179652454Illumina Small RNA Adapter 2 (100% over 21bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG362690.10895690727130015No Hit
GCGGCTGTAGCTCAGTTGGATAGAGTACTTGGCTGGAATTCTCGGGTGCC360680.1083530764967673No Hit
CTGGGCTGGGGTGCGGCCGAATGATGGCTGCTGGAATTCTCGGGTGCCAA358270.10762908039396923No Hit
TGGGCTGGGGTGCGGCCGAATGATGGCTGCCTGGAATTCTCGGGTGCCAA357160.10729562160803319No Hit
CTAATGCTGAGATACGAGACGAGCCTGGAATTCTCGGGTGCCAAGGAACT354040.10635833204756433RNA PCR Primer, Index 1 (100% over 25bp)
TGGTGACACGTTAAGCTAACTCATACTAATTGCCCGAGATGGAATTCTCG351770.1056763938096591No Hit
TGAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATGGAA350260.1052227696954578No Hit
TTGCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTC348830.10479317864690955No Hit
TTACTTGGATAACTGTGGCAATTCTAGAGCTAATACATGCAAACTGGAAT343250.10311687231760946No Hit

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTCTGTA233950.042.056773
GTTTCCG158250.041.884321
GCACCCC134450.041.0681927
TCCCATA66000.040.9716221
ACCCCTT105450.040.8459529
CGCACCC145450.040.83595726
CACCCCT132150.040.8004528
TCCCTCG110300.040.76722337
GCTTCCC110850.040.70252634
CTGCTTC111800.040.3758532
CGCGGGA316450.040.1721571
CGCCATC115200.040.136889
CTTCCCT112600.040.050435
AATCGCC125950.039.9593056
ATCTAAA116050.039.8618513
CCATCTA115450.039.82132311
ACGGCGC112950.039.72289344
TCCCTAG62450.039.5982551
TGGTAGC366400.039.3184118
GCGGGAT321450.039.3110432