FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_10_JG57_1_CTTGTA_L002_R1_001_TRIMMED_prinseq_good_aaY9.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_10_JG57_1_CTTGTA_L002_R1_001_TRIMMED_prinseq_good_aaY9.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences28441528
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG24786948.715052158941672No Hit
AACATTCAACGCTGTCGGTGAGT20730627.288855929259497No Hit
TTCAAGTAATCCAGGATAGGCT15158195.3295976221812No Hit
TCACAGTGAACCGGTCTCTTT11959214.204840893217833No Hit
AACATTCAACGCTGTCGGTGA6005502.1115250910569925No Hit
TGAGGTAGTAGGTTGTATAGTT5370641.8883092357063234No Hit
TCCCTGAGACCCTTAACCTGTG3419551.2023088211013135No Hit
TTAAAGGGAATTTGCGACTGTT2923691.0279651641782397No Hit
TAAAGCTAGAGAACCGAAAGTA2817670.9906886859243286No Hit
CCTGTCTGAGGGTCGCT2777680.9766282599162744No Hit
TCCCTGAGACCCTTAACCTGTGA2661960.935941275728927No Hit
AACATTCATTGCTGTCGGTGGG2235040.7858368228317409No Hit
AAGCTGCCAGCTGAAGAACTGT2215280.778889235486926No Hit
TAGCTTATCAGACTGGTGTTGGC2191350.7704754821892832No Hit
TCACAGTGAACCGGTCTCTTTT2175480.7648956132033412No Hit
TTCACAGTGGCTAAGTTCTGC2114690.7435219373586398No Hit
TCACAGTGAACCGGTCTCTT2090550.7350343483655308No Hit
TCTTTGGTTATCTAGCTGTATGA2070870.728114888904703No Hit
TCTTTGGTTATCTAGCTGTAT2052170.7215399960227172No Hit
TTGCATAGTCACAAAAGTGATC1967740.6918545304598263No Hit
AACATTCATTGCTGTCGGTGGGT1944290.683609544466106No Hit
AGCTACATCTGGCTACTGGGTCTC1720170.6048092774762313No Hit
TTCACAGTGGCTAAGTTCTG1674760.5888431873280507No Hit
TAACAGTCTACAGTCATGGCT1673910.5885443285606877No Hit
TGAGGTAGTAGTTTGTGCTGTT1570820.5522980340578045No Hit
TCCAGCATCAGTGATTTTGTTG1487720.523080194566199No Hit
TATTGCACTCGTCCCGGCCTCC1382200.4859795155872076No Hit
ACCTTGGCTTTAGACTGCTTACT1334970.46937351607832034No Hit
TCTTTGGTTATCTAGCTGTATG1323920.46548835210260153No Hit
TGAGGTAGTAGTTTGTATAGTT1313140.46169811973533914No Hit
TCCCTGAGACCCTAACTTGTGA1312300.46140277695347454No Hit
TCCAGCATCAGTGATTTTGTT1302390.4579184353245718No Hit
TTCCCTTTGTCATCCTATGCCTG1297330.4561393466623874No Hit
TAAAGCTAGAGAACCGAAAGT1285980.45214870312171695No Hit
CTGTCTGAGGGTCGCT1253350.4406760424404765No Hit
AACCCGTAGATCCGAACTTGTG1217580.42809936231274215No Hit
TCCCTGAGACCCTTAACCTGT1160720.4081074687689072No Hit
AAGCTGCCAGCTGAAGAACT1130460.39746809665078475No Hit
TAAAGGGAATTTGCGACTGTT1065020.3744594875493328No Hit
CCCTGAGACCCTTAACCTGTGA1063130.3737949662901374No Hit
TACCCTGTAGAACCGAATGTGT1055200.37100678978991564No Hit
TACCCTGTAGAACCGAATTTGT985160.34638082735920517No Hit
CTACGCCTGTCTGAGGGTCGCT967580.34019972485303884No Hit
AGCTGGTGTTGTGAATCAGGCCG952220.33479917112751467No Hit
AACTCCAGTCACCTTGTAATCT858210.30174539145716783Illumina PCR Primer Index 12 (100% over 22bp)
TCTTTGGTTATCTAGCTGTATGT826780.29069464903573394No Hit
TACCCTGTAGATCCGGATTTGT819860.28826158707084937No Hit
AGCTACATCTGGCTACTGGGTCT814530.2863875668002085No Hit
TGTCTGAGGGTCGCT797740.2804842271484148No Hit
TAGCAGCACGTAAATATTGGAG773050.27180325895289453No Hit
TGAGGTAGTAGGTTGTATAGT767840.2699714305082343No Hit
TGATGTAGTAGGTTGTATAGTT763600.26848065265691773No Hit
TGAGGTAGTTGGTTGTATAGTT749740.2636074967561518No Hit
TTCAAGTAATCCAGGATAGGTT747500.2628199160045129No Hit
AAGCTGCCAGTTGAAGAGCTGT742390.2610232474148365No Hit
TATTGCACTTGTCCCGGCCTGT723020.2542127835044587No Hit
AGAATAATGCCAGCAGTCGGTC709500.24945917111063795No Hit
TGTAAACATCCTTGACTGGAAGCT708650.24916031234327496No Hit
AACATTCAACGCTGTCGGTGG691730.24321126488000222No Hit
TTCAAGTAATCCAGGATAGGC666530.23435098142406413No Hit
TTCAAGTAATCCAGGATAGGCTT642030.22573681695301323No Hit
TAAATCTAGAGAACCGAAAGTA636620.2238346687983852No Hit
AACAGTCAACGCTGTCGGTGAG614580.21608543675993777No Hit
CCTTTCTGAGGGTCGCT608910.21409187298235172No Hit
AACTCCAGTCACCTTGTAATCTCG562240.19768276866137433Illumina PCR Primer Index 12 (100% over 24bp)
CCACGTTCCCGTGG553230.1945148657273266No Hit
ACCATCGACCGTTGACTGTACC529920.18631910353058387No Hit
AGCTACATTGTCTGCTGGGTTT529450.18615385221215963No Hit
TTGCATAGTCACAAAAATGAGC523670.1841216125940913No Hit
TAGCTTATCAGACTGGTGTTGG522650.1837629820732557No Hit
TACCCTGTAGAACCGAATTTGCG516860.18172722646968897No Hit
TGTAAACATCCTACACTCTCAGCT507380.17839407221721704No Hit
TGAGATGAAGCACTGTAGCTCT506180.17797215395741045No Hit
ACCATCGACCGTTGACTGTGCC504820.17749397992962965No Hit
AACAGTCAACGCTGTCGGTGAGT504200.1772759888287296No Hit
AACATTCATTGCTGTCGGTGGGTT502880.17681187874294238No Hit
AACATTCAACGCTGTCGGTGAGTT492130.17303219433217512No Hit
TTCCCTTTGTCATCCTATGCCT482380.1696041084712467No Hit
AATATTCAACGCTGTCGGTGAG459120.1614259262019959No Hit
ACCGTGGCTTTAGATTGTTACT457240.16076492092829892No Hit
TGAGATGAAGCACTGTAGCTC454010.15962925761231955No Hit
AGCTACATTGTCTGCTGGGTTTC451900.15888738467215968No Hit
AACATTCAACGCTGTCGGTGAGA441050.15507254040640855No Hit
AAGGTCCAACCTCACATGTCCT436050.1533145476572145No Hit
AACATTCAACGCTGTCGGTG423170.14878595833529057No Hit
AGCAGCATTGTACAGGGCTATGA417310.1467255908332351No Hit
TACCCTGTAGAACCGAATTTGC415310.1460223937335575No Hit
TCCCTGAGACCCTTAACCTGTGG409880.14411321360793275No Hit
TAACAGTCTACAGCCATGGTCG402910.1416625717155562No Hit
AACTCCAGTCACCTTGTAATCTCGTATGC389500.13694763516221772Illumina PCR Primer Index 12 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTT388830.13671206413382572No Hit
TACCCTGTAGATCCGGATTTGTG385590.13557288483234797No Hit
AATATTCAACGCTGTCGGTGAGT384850.13531270190546726No Hit
CATTATTACTTTTGGTACGCG383660.13489429963115906No Hit
TCCCTGAGACCCTAACTTGTG381990.13430713005292824No Hit
GTACAGTACTGTGATAACTGA372540.13098452375695147No Hit
TGCTCAGTAGTCAGTGTAGATCC371570.1306434731636078No Hit
CTTTGGTTATCTAGCTGTATGA368160.12944452210865745No Hit
AAGCCCTTACCCCAAAAAGCAT365850.12863232945852981No Hit
TGAGGTAGTTGGTTGTATTGTT362230.12735954270811328No Hit
TAAGGCACGCGGTGAATGCC346460.12181483357715521No Hit
AACTCCAGTCACCTTGTAATCTC339360.11931848387329964Illumina PCR Primer Index 12 (100% over 23bp)
TAAAGCTAGAGAACCGAAAGTAA335350.117908573688446No Hit
ATCTACATCTGGCTACTGGGTCTC323650.11379487065533188No Hit
CCTTGGCTTTAGACTGCTTACT323350.11368939109038025No Hit
TCCATCATCAGTGATTTTGTTG319110.11219861323906366No Hit
TAGCAGCACGGAATGGTTTGT318990.112156421413083No Hit
TACAGTACTGTGATAACTGAAG311600.10955810812977418No Hit
TTCACAGTGGCTAAGTTCTGCT308930.10861934000170456No Hit
TCACAGTGAACCGGTCTCT308470.1084576046687787No Hit
ACCATTGACCGTTGACTGTACC308470.1084576046687787No Hit
TTAGGTAGTAGGTTGTATAGTT306480.10775792355459946No Hit
TGCTCAGTAGTCAGTGTAGATC304460.10704769448392505No Hit
TGAGTTAGTAGGTTGTATAGTT300230.10556043261810688No Hit
AACCCGTAGATCCGAACTTGT299720.1053811173576891No Hit
AAGCTGCCAGCTGAAGAACTGC296860.10437554550515007No Hit
TAAATCTAGAGAACCGAAAGT287540.10109864702065234No Hit
CAGGCTGGTTAGATGGTTGTCT287090.10094042767322486No Hit
TTTAAGTAATCCAGGATAGGCT286740.1008173681807813No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC42150.02654.37723
CAACCCG4000.02232.228323
AATAACC6250.02034.7123
TAACTAA2450.01932.665223
CGTATGG307.2759576E-121803.82123
TAACTGC4050.01737.012623
GTATGCC650.01665.065423
CACCGAT50.00390567331447.811322
TCGTATG44250.01397.09722
ATAACTA35900.01369.169722
ACAACCC11600.01366.683822
CGTATTC403.092282E-111352.865623
GATTCCT3700.01133.48223
ATAAAAA2500.01100.336722
TAATAAC8150.01065.873422
TAACACC405.1953975E-81014.6492323
TCTGACT47800.0950.9682623
GATAAAA10600.0927.4707621
GACAACC22600.0915.692721
GATAACA9100.0896.6910421