FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_10_JG58_1_AGTCAA_L007_R1_001_TRIMMED_prinseq_good_5fPN.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_10_JG58_1_AGTCAA_L007_R1_001_TRIMMED_prinseq_good_5fPN.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19885349
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG15836357.9638280424447165No Hit
AACATTCAACGCTGTCGGTGAGT14002987.041857801942526No Hit
TTCAAGTAATCCAGGATAGGCT11085365.574636884673233No Hit
TCACAGTGAACCGGTCTCTTT7422443.7326174159679066No Hit
TGAGGTAGTAGGTTGTATAGTT3959411.991119190314437No Hit
AACATTCAACGCTGTCGGTGA3933761.9782202464739242No Hit
CCTGTCTGAGGGTCGCT2512271.2633773739651237No Hit
TCCCTGAGACCCTTAACCTGTG2264521.138788160066992No Hit
TAAAGCTAGAGAACCGAAAGTA2102241.0571803391532126No Hit
TTAAAGGGAATTTGCGACTGTT2081401.0467002615845464No Hit
TCCCTGAGACCCTTAACCTGTGA1880860.9458521447121698No Hit
TAGCTTATCAGACTGGTGTTGGC1719660.8647874372232541No Hit
TCTTTGGTTATCTAGCTGTATGA1701420.8556148549366671No Hit
TCTTTGGTTATCTAGCTGTAT1570290.7896718332677993No Hit
AAGCTGCCAGCTGAAGAACTGT1444920.7266254165315378No Hit
AACATTCATTGCTGTCGGTGGG1444340.7263337445070741No Hit
TTCACAGTGGCTAAGTTCTGC1422350.715275351717488No Hit
AACATTCATTGCTGTCGGTGGGT1390590.6993037939640888No Hit
TCACAGTGAACCGGTCTCTTTT1373300.6906089503382615No Hit
TTGCATAGTCACAAAAGTGATC1357020.6824220183412422No Hit
TGAGGTAGTAGTTTGTGCTGTT1350980.6793846062244118No Hit
TCACAGTGAACCGGTCTCTT1227520.6172986956376777No Hit
TCCAGCATCAGTGATTTTGTTG1185410.5961223008960014No Hit
TATTGCACTCGTCCCGGCCTCC1169210.5879755995230458No Hit
TGAGGTAGTAGTTTGTATAGTT1039980.5229880551756975No Hit
TCTTTGGTTATCTAGCTGTATG1037100.5215397527093942No Hit
TACCCTGTAGAACCGAATTTGT1036970.5214743779452903No Hit
TAACAGTCTACAGTCATGGCT1035100.5205339871077949No Hit
TTCACAGTGGCTAAGTTCTG1006140.5059705011966348No Hit
TACCCTGTAGAACCGAATGTGT983800.49473609942676894No Hit
AGCTGGTGTTGTGAATCAGGCCG967240.4864083602455255No Hit
CTGTCTGAGGGTCGCT966600.48608651525301366No Hit
TCCAGCATCAGTGATTTTGTT964090.4848242794230064No Hit
TTCCCTTTGTCATCCTATGCCTG895360.4502611445240413No Hit
AGCTACATCTGGCTACTGGGTCTC894300.4497280887551936No Hit
TAAAGCTAGAGAACCGAAAGT892020.44858151596937024No Hit
CCCTGAGACCCTTAACCTGTGA880820.4429492286004133No Hit
ACCTTGGCTTTAGACTGCTTACT872780.43890605088198353No Hit
TACCCTGTAGATCCGGATTTGT858670.43181037456269944No Hit
TCCCTGAGACCCTAACTTGTGA840900.42287414719248834No Hit
TAAAGGGAATTTGCGACTGTT840810.4228288877404163No Hit
AACCCGTAGATCCGAACTTGTG822340.41354064240964544No Hit
CTACGCCTGTCTGAGGGTCGCT820810.4127712317244218No Hit
TCCCTGAGACCCTTAACCTGT749290.37680505381122553No Hit
TATTGCACTTGTCCCGGCCTGT668250.33605143163441586No Hit
AAGCTGCCAGCTGAAGAACT654260.32901610125122777No Hit
TGTCTGAGGGTCGCT622030.3128081885814526No Hit
TCTTTGGTTATCTAGCTGTATGT611750.30763855338923146No Hit
TGAGGTAGTTGGTTGTATAGTT610250.3068842291880319No Hit
AAGCTGCCAGTTGAAGAGCTGT593290.29835533688646854No Hit
AACTCCAGTCACAGTCAAATCT581980.2926677324094237TruSeq Adapter, Index 13 (95% over 22bp)
TACCCTGTAGAACCGAATTTGCG571170.2872315693327786No Hit
TGAGGTAGTAGGTTGTATAGT550320.2767464629361044No Hit
TAGCAGCACGTAAATATTGGAG541300.27221046007289085No Hit
TGTAAACATCCTTGACTGGAAGCT533580.26832820485071696No Hit
TTCAAGTAATCCAGGATAGGTT521670.2623388706931923No Hit
CCACGTTCCCGTGG495570.24921362959231946No Hit
TTCAAGTAATCCAGGATAGGC489440.24613095802341717No Hit
AACATTCAACGCTGTCGGTGG475250.23899505108006905No Hit
TTCAAGTAATCCAGGATAGGCTT459940.23129591539982527No Hit
AGAATAATGCCAGCAGTCGGTC445610.22408960486436522No Hit
CCTTTCTGAGGGTCGCT444510.22353643378348553No Hit
TACCCTGTAGAACCGAATTTGC441040.2217914304647105No Hit
AACTCCAGTCACAGTCAAATCTCG439370.22095161618737497TruSeq Adapter, Index 13 (95% over 24bp)
TGTAAACATCCTACACTCTCAGCT435890.21920158404059187No Hit
TACCCTGTAGATCCGGATTTGTG430820.2166519682405373No Hit
ACCATCGACCGTTGACTGTACC413230.20780625977447012No Hit
AGCTACATCTGGCTACTGGGTCT408680.20551814303083138No Hit
TTGCATAGTCACAAAAATGAGC390980.19661711745667626No Hit
ACCGTGGCTTTAGATTGTTACT376760.18946612402930418No Hit
AACATTCATTGCTGTCGGTGGGTT361260.18167144061690846No Hit
TGAGATGAAGCACTGTAGCTC357290.17967499589773356No Hit
TAGCTTATCAGACTGGTGTTGG353870.17795513671899849No Hit
TGAGATGAAGCACTGTAGCTCT352420.1772259566578389No Hit
AACATTCAACGCTGTCGGTGAGTT349760.17588828840771162No Hit
ACCATCGACCGTTGACTGTGCC347350.1746763408577843No Hit
AAGGTCCAACCTCACATGTCCT344930.17345936447984894No Hit
TGATGTAGTAGGTTGTATAGTT337030.16948659035353114No Hit
CTTTGGTTATCTAGCTGTATGA323800.1628334508989508No Hit
TTCCCTTTGTCATCCTATGCCT322990.162426115830303No Hit
AGCAGCATTGTACAGGGCTATGA321050.16145052319675154No Hit
TAAATCTAGAGAACCGAAAGTA314440.15812646788346535No Hit
TTATGTAGTAGGTTGTATAGTT310420.15610487902425046No Hit
TCCCTGAGACCCTTAACCTGTGG306160.15396259829284364No Hit
AACATTCAACGCTGTCGGTGAGA305130.15344462900801992No Hit
AACTCCAGTCACAGTCAAATCTC300400.1510659933602372TruSeq Adapter, Index 13 (95% over 23bp)
TGAGGTAGTTGGTTGTATTGTT298090.14990433409038986No Hit
CATTATTACTTTTGGTACGCG296760.14923549996532623No Hit
TGAGGTAGTAGGTTGTATAGTTT290120.14589635816801605No Hit
TAACAGTCTACAGCCATGGTCG284620.14313050276361758No Hit
AACAGTCAACGCTGTCGGTGAG273900.13773959913904452No Hit
CCTTGGCTTTAGACTGCTTACT273820.13769936851498055No Hit
AACATTCAACGCTGTCGGTG266250.13389254571292664No Hit
AATATTCAACGCTGTCGGTGAG264760.13314325033973506No Hit
TAAGGCACGCGGTGAATGCC264470.13299741432750312No Hit
CAGGCTGGTTAGATGGTTGTCT260620.13106131554442418No Hit
AAGCCCTTACCCCAAAAAGCAT257710.12959792659409697No Hit
AACTCCAGTCACAGTCAAATCTCGTATGC250920.12618335237666686TruSeq Adapter, Index 13 (96% over 29bp)
GTACAGTACTGTGATAACTGA249550.12549440293957126No Hit
AGCTACATTGTCTGCTGGGTTT244090.12274866284720475No Hit
TACAGTACTGTGATAACTGAAG242340.12186861794580522No Hit
TCCCTGAGACCCTAACTTGTG240520.12095337124834973No Hit
AACAGTCAACGCTGTCGGTGAGT240200.12079244875209381No Hit
AATATTCAACGCTGTCGGTGAGT238400.11988725971065431No Hit
TACCCTGTAGAACCGAATGTGTG237120.11924356972563066No Hit
AGCTACATTGTCTGCTGGGTTTC225610.11345538868842582No Hit
GAAGGATCATTA225570.11343527337639384No Hit
CACCACGTTCCCGTGG224790.11304302479177007No Hit
ACCATTGACCGTTGACTGTACC222820.11205234567419461No Hit
TAAAGCTAGAGAACCGAAAGTAA222110.11169529888562679No Hit
TTAGGTAGTAGGTTGTATAGTT214430.10783315897548493No Hit
TTCACAGTGGCTAAGTTCTGCT214110.10767223647922901No Hit
TGTAAACATCCCCGACTGGAAGCT212530.10687768165396545No Hit
CTTTTTGCGGTCTGGGCTTGC210050.10563053230798211No Hit
TAAGGCACGCGGTGAATGCCA200210.10068216554811284No Hit
TGCTCAGTAGTCAGTGTAGATCC199580.100365349383609No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC29750.02314.845523
TAACTAA1800.02180.57923
CAACCCG3200.02118.630623
TAACTGC2650.01885.097423
GTATGCC850.01819.092723
AATAACC4800.01734.551523
CGTATTC155.4656884E-61585.875723
ATAACTA23400.01243.283922
ACAACCC10400.01230.851222
TCGTATG31050.01230.550822
GGCAACA100.0057852291189.406723
ACGTATG206.228947E-8969.761522
CTAAGCC252.5288182E-5951.525423
TAATAAC6600.0930.579222
AAATAGC408.6889486E-8892.0550523
TCTGACT35300.0886.1585723
CCTAAGC153.4024877E-5862.0102522
GCACCCA302.928573E-10862.0102522
GACAACC17300.0816.464421
GATAAAA7150.0797.562721