FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_10_JG59_1_AGTTCC_L008_R1_001_TRIMMED_prinseq_good_5DFM.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_10_JG59_1_AGTTCC_L008_R1_001_TRIMMED_prinseq_good_5DFM.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19328687
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG15754378.150770924067425No Hit
AACATTCAACGCTGTCGGTGAGT13788477.133681661873877No Hit
TTCAAGTAATCCAGGATAGGCT11476005.937288963290678No Hit
TCACAGTGAACCGGTCTCTTT9009294.661097776584618No Hit
AACATTCAACGCTGTCGGTGA4245962.1967141379029007No Hit
TGAGGTAGTAGGTTGTATAGTT3947232.042161477393679No Hit
CCTGTCTGAGGGTCGCT2056301.06385912297095No Hit
TAAAGCTAGAGAACCGAAAGTA2005611.0376338547983108No Hit
TCCCTGAGACCCTTAACCTGTG1977851.0232717825064888No Hit
TTAAAGGGAATTTGCGACTGTT1928040.9975017961644265No Hit
TCACAGTGAACCGGTCTCTTTT1749800.9052865308440248No Hit
TCCCTGAGACCCTTAACCTGTGA1687900.8732615929887012No Hit
TCTTTGGTTATCTAGCTGTAT1601640.828633626277874No Hit
TTGCATAGTCACAAAAGTGATC1600660.828126607875641No Hit
TCTTTGGTTATCTAGCTGTATGA1528650.7908711026258534No Hit
TCACAGTGAACCGGTCTCTT1493880.7728822966609165No Hit
TTCACAGTGGCTAAGTTCTGC1486010.7688106284715562No Hit
AAGCTGCCAGCTGAAGAACTGT1466480.7587064760270575No Hit
TAGCTTATCAGACTGGTGTTGGC1413100.731089494076861No Hit
AACATTCATTGCTGTCGGTGGG1367380.7074355335155461No Hit
TGAGGTAGTAGTTTGTGCTGTT1307100.6762487281210565No Hit
AACATTCATTGCTGTCGGTGGGT1279070.6617469670857622No Hit
AGCTACATCTGGCTACTGGGTCTC1233370.6381033538387786No Hit
TAACAGTCTACAGTCATGGCT1187490.6143666147628134No Hit
TTCACAGTGGCTAAGTTCTG1088990.5634060916812405No Hit
TCCAGCATCAGTGATTTTGTTG1039030.5375585004816934No Hit
TGAGGTAGTAGTTTGTATAGTT972980.5033864949026284No Hit
TCTTTGGTTATCTAGCTGTATG971930.502843260900236No Hit
ACCTTGGCTTTAGACTGCTTACT971490.5026156199849477No Hit
TCCCTGAGACCCTAACTTGTGA949610.4912956581065232No Hit
TATTGCACTCGTCCCGGCCTCC940080.48636516282766645No Hit
TAAAGCTAGAGAACCGAAAGT875830.4531244155384171No Hit
TCCAGCATCAGTGATTTTGTT860890.445394971732948No Hit
CTGTCTGAGGGTCGCT815950.4221445564305532No Hit
TTCCCTTTGTCATCCTATGCCTG802360.41511355634244584No Hit
CCCTGAGACCCTTAACCTGTGA796730.4122007873581894No Hit
AACCCGTAGATCCGAACTTGTG794080.41082976820929434No Hit
AGCTGGTGTTGTGAATCAGGCCG774230.4005600587354951No Hit
TCCCTGAGACCCTTAACCTGT702270.36333042177153574No Hit
TACCCTGTAGAACCGAATGTGT685040.3544162104751347No Hit
TAAAGGGAATTTGCGACTGTT683670.35370741944344175No Hit
AAGCTGCCAGCTGAAGAACT650190.3363860152528726No Hit
TAGCAGCACGTAAATATTGGAG646080.33425964215779375No Hit
CTACGCCTGTCTGAGGGTCGCT645800.3341147797571558No Hit
AACTCCAGTCACAGTTCCATCT641590.3319366700904205TruSeq Adapter, Index 14 (95% over 22bp)
AGCTACATCTGGCTACTGGGTCT625760.32374677079720937No Hit
TCTTTGGTTATCTAGCTGTATGT609060.31510676333058735No Hit
TATTGCACTTGTCCCGGCCTGT586150.30325391476410163No Hit
TGAGGTAGTAGGTTGTATAGT572000.29593318987471834No Hit
TTCAAGTAATCCAGGATAGGTT561220.29035598745015634No Hit
TGAGGTAGTTGGTTGTATAGTT545250.2820936569566262No Hit
AAGCTGCCAGTTGAAGAGCTGT539420.2790774148290569No Hit
TACCCTGTAGAACCGAATTTGT526530.2724085707425445No Hit
TTCAAGTAATCCAGGATAGGC519510.26877666341226386No Hit
TGTCTGAGGGTCGCT505840.26170427406683133No Hit
TTCAAGTAATCCAGGATAGGCTT502640.26004870377382594No Hit
TGTAAACATCCTTGACTGGAAGCT475460.24598670359761116No Hit
AACTCCAGTCACAGTTCCATCTCG474510.24549520616687515TruSeq Adapter, Index 14 (95% over 24bp)
AACATTCAACGCTGTCGGTGG473950.24520548136559925No Hit
TAAATCTAGAGAACCGAAAGTA456550.23620331789738228No Hit
AGAATAATGCCAGCAGTCGGTC438590.22691142962788938No Hit
AACTCCAGTCACAGTTCCATCTCGTATGC430700.22282941412419788TruSeq Adapter, Index 14 (96% over 29bp)
CCACGTTCCCGTGG420590.2175988467297339No Hit
TTGCATAGTCACAAAAATGAGC412010.2131598488816131No Hit
ACCGTGGCTTTAGATTGTTACT389380.20145186271576543No Hit
TGTAAACATCCTACACTCTCAGCT375730.1943898206846642No Hit
AGCTACATTGTCTGCTGGGTTT371740.19232553147557307No Hit
ACCATCGACCGTTGACTGTACC366890.18981630775023675No Hit
TGAGATGAAGCACTGTAGCTCT364770.18871949243112063No Hit
TACCCTGTAGATCCGGATTTGT343490.17770994998263462No Hit
TAGCTTATCAGACTGGTGTTGG341360.17660796100635287No Hit
TTCCCTTTGTCATCCTATGCCT338790.17527833111478291No Hit
AGCTACATTGTCTGCTGGGTTTC333920.1727587600751153No Hit
AACATTCAACGCTGTCGGTGAGA333310.17244316698801115No Hit
ACCATCGACCGTTGACTGTGCC327600.16948900874642958No Hit
TGAGATGAAGCACTGTAGCTC322100.16664349730532654No Hit
AACATTCAACGCTGTCGGTGAGTT315560.1632599255189967No Hit
TAACAGTCTACAGCCATGGTCG314420.16267012860211352No Hit
AACATTCATTGCTGTCGGTGGGTT311570.1611956363099056No Hit
CCTTTCTGAGGGTCGCT309060.15989704836132945No Hit
AACTCCAGTCACAGTTCCATCTC306980.15882092767087594TruSeq Adapter, Index 14 (95% over 23bp)
TGAGGTAGTAGGTTGTATAGTTT306240.15843807704061844No Hit
AAGGTCCAACCTCACATGTCCT305770.15819491515383327No Hit
AGCAGCATTGTACAGGGCTATGA293370.15177958026843727No Hit
AACATTCAACGCTGTCGGTG288310.14916170974262247No Hit
AACAGTCAACGCTGTCGGTGAG285890.1479096847085371No Hit
TGCTCAGTAGTCAGTGTAGATCC285750.1478372535082181No Hit
CATTATTACTTTTGGTACGCG283990.14692668984706514No Hit
CTTTGGTTATCTAGCTGTATGA281120.14544185024052592No Hit
ATCTACATCTGGCTACTGGGTCTC277260.14344481857458813No Hit
TGATGTAGTAGGTTGTATAGTT277260.14344481857458813No Hit
TGAGGTAGTTGGTTGTATTGTT267960.13863331741054113No Hit
AAGCCCTTACCCCAAAAAGCAT266400.137826226892701No Hit
GTACAGTACTGTGATAACTGA264140.13665698037326593No Hit
TGAGTTAGTAGGTTGTATAGTT259210.13410636739060444No Hit
TACCCTGTAGAACCGAATTTGCG257120.13302507304298528No Hit
TCCCTGAGACCCTTAACCTGTGG249770.12922243502623845No Hit
TAAGGCACGCGGTGAATGCC248160.1283894762225701No Hit
TACAGTACTGTGATAACTGAAG240660.12450923334833867No Hit
TCCCTGAGACCCTAACTTGTG237550.12290022596982403No Hit
AACAGTCAACGCTGTCGGTGAGT235950.12207244082332132No Hit
CCTTGGCTTTAGACTGCTTACT234410.12127569761981247No Hit
AATATTCAACGCTGTCGGTGAG234390.12126535030548118No Hit
TAAAGCTAGAGAACCGAAAGTAA231050.11953734881215677No Hit
TGCTCAGTAGTCAGTGTAGATC230850.11943387566884395No Hit
TAGCAGCACGGAATGGTTTGT230560.11928383961104033No Hit
TTAGGTAGTAGGTTGTATAGTT229310.11863713246533507No Hit
TCACAGTGAACCGGTCTCT228550.11824393452074629No Hit
TTCACAGTGGCTAAGTTCTGCT224400.11609686679700489No Hit
CAGGCTGGTTAGATGGTTGTCT218340.11296163055462588No Hit
AATATTCAACGCTGTCGGTGAGT214920.11119223980397634No Hit
TCCATCATCAGTGATTTTGTTG210920.10912277693771956No Hit
TTCACAGTGGTTAAGTTCTG209620.10845020150618613No Hit
TGAGGTAGTAGATTGAATAGTT208880.10806735087592861No Hit
TCGTACCGTGAGTAATAATGCA206080.10661872686954887No Hit
CTTTTTGCGGTCTGGGCTTGC201250.10411985045854383No Hit
TGAGGTAGTAGGTTGTGTGGTT201130.10405776657255612No Hit
TAATCTCTGCAGGCAACTGTGA200590.10377838908561146No Hit
TAAATCTAGAGAACCGAAAGT199540.10323515508321905No Hit
CACCACGTTCCCGTGG197960.10241771725104762No Hit
GAAGGATCATTA196990.10191587250598037No Hit
TGAGATGAAGCACTGTAGCT196950.10189517787731778No Hit
TACCCTGTAGAACCGAATTTGC196630.10172962084801726No Hit
AACCCGTAGATCCGAACTTGT195890.10134677021775974No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC46350.02067.546423
CAACCCG2550.01921.972723
TAACTGC2750.01782.192923
AATAACC3750.01612.821423
TAACTAA2150.01600.534323
GATTCCT4300.01430.780623
GTATGCC400.01303.465523
AAATAGC500.01251.326823
GCAAGGT50.00567993341200.493922
TCGTATG48300.01169.425322
ACAACCC9300.01142.405522
ATAACTA26400.01132.28422
TAAGCCT100.00752635441042.772323
ATAAAAA2850.0947.758422
TAATAAC5550.0897.666722
TCTGACT35300.0830.082223
ATAACCA154.2509124E-5800.329222
GGATTCC5950.0796.966622
GACAACC14900.0796.4673521
GCTGAGC1850.0789.1250623