FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_10_JG60_1_ATGTCA_L001_R1_001_TRIMMED_prinseq_good_Mw8b.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_10_JG60_1_ATGTCA_L001_R1_001_TRIMMED_prinseq_good_Mw8b.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20135638
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG17392278.63755595924003No Hit
AACATTCAACGCTGTCGGTGAGT14760347.330455583279755No Hit
TTCAAGTAATCCAGGATAGGCT10603535.266051167586545No Hit
TCACAGTGAACCGGTCTCTTT8513964.228304064663856No Hit
AACATTCAACGCTGTCGGTGA4591172.280121444376384No Hit
TGAGGTAGTAGGTTGTATAGTT3627671.8016166162701175No Hit
TCCCTGAGACCCTTAACCTGTG2142891.064227515413219No Hit
TTGCATAGTCACAAAAGTGATC2129241.0574484900850918No Hit
TTAAAGGGAATTTGCGACTGTT2093311.0396045061994061No Hit
TAAAGCTAGAGAACCGAAAGTA1895700.9414650779875959No Hit
AGCTACATCTGGCTACTGGGTCTC1841140.914368841950774No Hit
CCTGTCTGAGGGTCGCT1779430.8837216878849332No Hit
TCCCTGAGACCCTTAACCTGTGA1653380.8211212378768431No Hit
TCACAGTGAACCGGTCTCTTTT1614680.8019015836498451No Hit
AAGCTGCCAGCTGAAGAACTGT1597910.793573066818146No Hit
TCACAGTGAACCGGTCTCTT1509710.7497701339287088No Hit
AACATTCATTGCTGTCGGTGGG1489190.7395792475013705No Hit
TAGCTTATCAGACTGGTGTTGGC1399090.6948327140168093No Hit
AACATTCATTGCTGTCGGTGGGT1308780.6499818878348926No Hit
TAACAGTCTACAGTCATGGCT1290860.6410822443271974No Hit
TTCACAGTGGCTAAGTTCTGC1285580.6384600279365372No Hit
TCTTTGGTTATCTAGCTGTATGA1255670.6236057680417179No Hit
TCTTTGGTTATCTAGCTGTAT1223200.6074801305029421No Hit
TCCAGCATCAGTGATTTTGTTG1101350.5469655344419679No Hit
TTCCCTTTGTCATCCTATGCCTG1075540.5341474653050478No Hit
TTCACAGTGGCTAAGTTCTG1070930.5318579922821418No Hit
TATTGCACTCGTCCCGGCCTCC1055420.5241552316345774No Hit
TGAGGTAGTAGTTTGTGCTGTT1019050.5060927297163368No Hit
AAGCTGCCAGCTGAAGAACT917850.45583358222868325No Hit
AGCTGGTGTTGTGAATCAGGCCG915080.45445791188737106No Hit
TCCAGCATCAGTGATTTTGTT889410.4417093712153546No Hit
TGAGGTAGTAGTTTGTATAGTT850390.4223307947828621No Hit
TAAAGCTAGAGAACCGAAAGT835450.414911114313835No Hit
ACCTTGGCTTTAGACTGCTTACT833900.41414133488097077No Hit
TAAAGGGAATTTGCGACTGTT833040.4137142314537041No Hit
AGCTACATCTGGCTACTGGGTCT816540.40551980523289105No Hit
TCCCTGAGACCCTAACTTGTGA810830.4026840371285975No Hit
AACCCGTAGATCCGAACTTGTG798440.39653076798460524No Hit
TACCCTGTAGAACCGAATTTGT795170.3949067816972077No Hit
TCTTTGGTTATCTAGCTGTATG794790.3947180615781829No Hit
TACCCTGTAGAACCGAATGTGT767520.3811749098786937No Hit
TCCCTGAGACCCTTAACCTGT745650.37031357039692514No Hit
CTACGCCTGTCTGAGGGTCGCT695300.34530815462614095No Hit
CCCTGAGACCCTTAACCTGTGA693770.3445483078311201No Hit
CTGTCTGAGGGTCGCT681350.3383801397303627No Hit
TATTGCACTTGTCCCGGCCTGT631040.31339458923526536No Hit
TACCCTGTAGATCCGGATTTGT621650.3087312157677845No Hit
TGAGGTAGTTGGTTGTATAGTT552300.27428979404576104No Hit
AACATTCAACGCTGTCGGTGG545550.27093752877361027No Hit
TGAGGTAGTAGGTTGTATAGT544970.2706494822761514No Hit
TTCAAGTAATCCAGGATAGGC491840.2442634298451333No Hit
TTCAAGTAATCCAGGATAGGTT486280.24150215652466536No Hit
ACCATCGACCGTTGACTGTGCC484620.24067774758366237No Hit
AGCTACATTGTCTGCTGGGTTT483930.24033507157806472No Hit
TGTAAACATCCTTGACTGGAAGCT478560.2376681583171092No Hit
TAGCAGCACGTAAATATTGGAG477690.23723608857092088No Hit
AAGCTGCCAGTTGAAGAGCTGT475380.23608886890000702No Hit
TTCAAGTAATCCAGGATAGGCTT462340.22961278902610388No Hit
TCTTTGGTTATCTAGCTGTATGT460770.2288330769553962No Hit
AACAGTCAACGCTGTCGGTGAG456180.22655353657033364No Hit
TACCCTGTAGAACCGAATTTGCG451580.2242690298663494No Hit
TTGCATAGTCACAAAAATGAGC440040.21853789783070196No Hit
TGTCTGAGGGTCGCT435640.2163527175051518No Hit
AGAATAATGCCAGCAGTCGGTC432070.21457974165010316No Hit
ACCGTGGCTTTAGATTGTTACT418160.20767159203001168No Hit
AGCTACATTGTCTGCTGGGTTTC390750.19405891186561855No Hit
ACCATCGACCGTTGACTGTACC387860.19262364569724585No Hit
TGCTCAGTAGTCAGTGTAGATCC384190.19080100665298017No Hit
AACAGTCAACGCTGTCGGTGAGT383220.19031927371757476No Hit
AACTCCAGTCACATGTCAATCT365790.18166297983704316TruSeq Adapter, Index 15 (95% over 22bp)
TGATGTAGTAGGTTGTATAGTT365140.18134016910713233No Hit
TAGCTTATCAGACTGGTGTTGG363310.18043133274446035No Hit
AACATTCAACGCTGTCGGTGAGA354420.1760162752230647No Hit
TAACAGTCTACAGCCATGGTCG335950.16684348417467576No Hit
TACCCTGTAGAACCGAATTTGC334700.16622269430946265No Hit
AGCAGCATTGTACAGGGCTATGA332480.16512017150884417No Hit
AACATTCAACGCTGTCGGTGAGTT331770.16476756286540314No Hit
AACATTCAACGCTGTCGGTG330200.16398785079469544No Hit
TGAGATGAAGCACTGTAGCTCT327970.16288036167515527No Hit
TTCCCTTTGTCATCCTATGCCT327200.162497955118184No Hit
TGTAAACATCCTACACTCTCAGCT325120.16146496078246936No Hit
TGCTCAGTAGTCAGTGTAGATC320530.15918542039740682No Hit
AACATTCATTGCTGTCGGTGGGTT317200.1575316361964791No Hit
AAGGTCCAACCTCACATGTCCT306830.15238156347467113No Hit
TACCCTGTAGATCCGGATTTGTG305730.1518352683932836No Hit
TGAGATGAAGCACTGTAGCTC297850.14792180908298014No Hit
CCACGTTCCCGTGG287690.14287602905852798No Hit
TAAATCTAGAGAACCGAAAGTA283480.1407852087924902No Hit
CTTTGGTTATCTAGCTGTATGA283210.1406511181816042No Hit
AAGCCCTTACCCCAAAAAGCAT276650.13739321296896576No Hit
CCTTTCTGAGGGTCGCT268260.13322647139365537No Hit
GTACAGTACTGTGATAACTGA266450.13232756766882678No Hit
TGAGGTAGTAGGTTGTATAGTTT262470.13035097273798824No Hit
AAGCTGCCAGCTGAAGAACTGC261770.1300033304134689No Hit
TATGGCTTTTTATTCCTATCTG257730.12799693756910013No Hit
TCCCTGAGACCCTTAACCTGTGG257540.12790257750958772No Hit
AACTTTCAACGCTGTCGGTGAG255090.12668582937377001No Hit
TACAGTACTGTGATAACTGAAG254900.12659146931425766No Hit
TGAGGTAGTTGGTTGTATTGTT253330.12581175724354995No Hit
CAGGCTGGTTAGATGGTTGTCT249420.12386992654516335No Hit
AATATTCAACGCTGTCGGTGAG244780.12156555456549228No Hit
AACTCCAGTCACATGTCAATCTCG234450.11643534711937113TruSeq Adapter, Index 15 (95% over 24bp)
TTAGGTAGTAGGTTGTATAGTT234250.11633602074093705No Hit
CATTATTACTTTTGGTACGCG234030.11622676172465952No Hit
TCCCTGAGACCCTAACTTGTG233850.11613736798406883No Hit
TCACAGTGAACCGGTCTCT230040.11424520047489928No Hit
TTACAATTAAAGGATATTTCTT228150.11330656619869706No Hit
TTCACAGTGGCTAAGTTCTGCT225180.1118315694789507No Hit
AACTTTCAACGCTGTCGGTGAGT221580.11004369466713695No Hit
ATCTACATCTGGCTACTGGGTCTC218060.10829555040669683No Hit
TAAGGCACGCGGTGAATGCC214150.1063537197083102No Hit
AACGTTCAACGCTGTCGGTGAG213530.10604580793516451No Hit
TAAAGCTAGAGAACCGAAAGTAA212600.10558394027544596No Hit
AATATTCAACGCTGTCGGTGAGT210800.10469000286953908No Hit
AACATTCATTGCTGTCGCTGGGT208780.10368680644735467No Hit
AGCTACATCTGGCTACTGGGTCTCT207590.1030958144956718No Hit
CCTTGGCTTTAGACTGCTTACT206250.10243032776016336No Hit
ACCATTGACCGTTGACTGTACC204100.10136256919199679No Hit
TGTAAACATCCCCGACTGGAAGCT203630.10112915220267668No Hit
AACCCGTAGATCCGAACTTGT202460.1005480928888372No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCGACG50.00141939372401.604223
CGTATGC15400.02354.819623
CAACCCG5050.02163.821523
AATAACC4000.01861.243223
TAACTAA2000.01801.203123
TAACTGC3750.01505.005423
ACGGGAA50.0051772421257.441522
TCGTATG15900.01217.899222
ACAACCC13700.01206.960222
AAATAGC201.2586681E-51200.802123
ACTAGGC100.0056761200.802123
ACTAAGA100.0056761200.802123
ATAACTA28050.01194.681522
TAAAAAA1450.01076.581223
TAAACCA600.01000.668423
CGTATTC252.4575696E-5960.6416623
AAACCCG252.4575696E-5960.6416623
TCTGACT36850.0954.776223
GATTCCT2150.0949.4714423
ATCACTA206.964365E-8943.081222