FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_10_JG62_1_GGCTAC_L001_R1_001_TRIMMED_prinseq_good_aYgU.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_10_JG62_1_GGCTAC_L001_R1_001_TRIMMED_prinseq_good_aYgU.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19317934
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG16113568.341243944616437No Hit
AACATTCAACGCTGTCGGTGAGT12881626.668218247355022No Hit
TTCAAGTAATCCAGGATAGGCT9459834.896915995261191No Hit
TCACAGTGAACCGGTCTCTTT6421783.3242581737777965No Hit
TGAGGTAGTAGGTTGTATAGTT4399722.2775313343549057No Hit
AACATTCAACGCTGTCGGTGA3551861.8386334687756984No Hit
TCCCTGAGACCCTTAACCTGTG2145641.110698483595606No Hit
TACCCTGTAGAACCGAATTTGT1951461.0101804882447574No Hit
TTGCATAGTCACAAAAGTGATC1879860.9731164833672171No Hit
TAGCTTATCAGACTGGTGTTGGC1854900.9601958470300188No Hit
TTAAAGGGAATTTGCGACTGTT1852840.9591294804092404No Hit
TAAAGCTAGAGAACCGAAAGTA1770360.9164334032821523No Hit
TCCCTGAGACCCTTAACCTGTGA1660470.8595484382543185No Hit
TACCCTGTAGAACCGAATGTGT1635670.8467106265090252No Hit
TTCACAGTGGCTAAGTTCTGC1492720.7727120301787965No Hit
AAGCTGCCAGCTGAAGAACTGT1407290.7284888746384577No Hit
CCTGTCTGAGGGTCGCT1368270.7082900272875972No Hit
AACATTCATTGCTGTCGGTGGG1285330.6653558294587816No Hit
TTCACAGTGGCTAAGTTCTG1281570.6634094515490114No Hit
TGAGGTAGTAGTTTGTGCTGTT1276810.6609454199398341No Hit
TCTTTGGTTATCTAGCTGTAT1260800.6526577842123283No Hit
TCACAGTGAACCGGTCTCTTTT1251580.6478850171037959No Hit
TCTTTGGTTATCTAGCTGTATGA1219110.631076801484051No Hit
TCACAGTGAACCGGTCTCTT1140760.5905186341355136No Hit
AACATTCATTGCTGTCGGTGGGT1124780.58224652801899No Hit
AGCTACATCTGGCTACTGGGTCTC1120560.5800620294074925No Hit
TACCCTGTAGATCCGGATTTGT1074200.5560636039029847No Hit
TCCAGCATCAGTGATTTTGTTG1065400.5515082513482031No Hit
TCCAGCATCAGTGATTTTGTT1053450.5453222896402897No Hit
TAACAGTCTACAGTCATGGCT985150.5099665419707925No Hit
TGAGGTAGTAGTTTGTATAGTT980480.5075490991945619No Hit
TATTGCACTCGTCCCGGCCTCC933540.4832504345443979No Hit
AACCCGTAGATCCGAACTTGTG881590.456358324860205No Hit
TACCCTGTAGAACCGAATTTGCG874950.45292110429614263No Hit
TCCCTGAGACCCTAACTTGTGA851140.44059576971326225No Hit
TAAAGCTAGAGAACCGAAAGT807380.41794324382721254No Hit
TTCCCTTTGTCATCCTATGCCTG790120.409008540975448No Hit
TCTTTGGTTATCTAGCTGTATG764640.39581872471455803No Hit
AGCTGGTGTTGTGAATCAGGCCG724310.37494175101747423No Hit
TAAAGGGAATTTGCGACTGTT712360.36875578930956077No Hit
TCCCTGAGACCCTTAACCTGT699890.3623006476779556No Hit
CCCTGAGACCCTTAACCTGTGA650890.3369356164070133No Hit
AAGCTGCCAGCTGAAGAACT642540.3326132080169649No Hit
ACCTTGGCTTTAGACTGCTTACT636750.32961599309739853No Hit
TGAGGTAGTAGGTTGTATAGT630190.32622018482928866No Hit
TGAGGTAGTTGGTTGTATAGTT588450.3046133194160411No Hit
CTGTCTGAGGGTCGCT584430.302532351544425No Hit
TACCCTGTAGAACCGAATTTGC583730.3021699939548401No Hit
CTACGCCTGTCTGAGGGTCGCT575470.29789417439773835No Hit
TGTAAACATCCTTGACTGGAAGCT540190.2796313518826599No Hit
AAGCTGCCAGTTGAAGAGCTGT513110.2656132897027187No Hit
TATTGCACTTGTCCCGGCCTGT507810.2628697250958617No Hit
AGAATAATGCCAGCAGTCGGTC503210.2604885180785896No Hit
TTCAAGTAATCCAGGATAGGTT502070.2598983928612656No Hit
TACCCTGTAGATCCGGATTTGTG497840.25770871771277404No Hit
AGCTACATCTGGCTACTGGGTCT481080.24903284171071297No Hit
TAGCAGCACGTAAATATTGGAG476700.24676551850731035No Hit
TTCAAGTAATCCAGGATAGGC465310.2408694428710648No Hit
TCTTTGGTTATCTAGCTGTATGT452240.23410370901981548No Hit
TGAGATGAAGCACTGTAGCTCT439990.22776245120207989No Hit
TGATGTAGTAGGTTGTATAGTT424550.21976987808323603No Hit
TTCAAGTAATCCAGGATAGGCTT423400.21917457632891799No Hit
TAGCTTATCAGACTGGTGTTGG405290.20979986783265747No Hit
TGAGATGAAGCACTGTAGCTC402060.2081278463835729No Hit
TAAGGCACGCGGTGAATGCC391120.20246471491206047No Hit
TACCCTGTAGAACCGAATGTGTG385980.19980397489710858No Hit
ACCATCGACCGTTGACTGTGCC384630.1991051424029091No Hit
TGTCTGAGGGTCGCT384610.199094789328921No Hit
AACAGTCAACGCTGTCGGTGAG371650.19238599738460646No Hit
TTGCATAGTCACAAAAATGAGC369670.1913610430597806No Hit
AACATTCAACGCTGTCGGTGG368060.19052762060373538No Hit
AGCTACATTGTCTGCTGGGTTT360520.1866245117102067No Hit
AACTCCAGTCACGGCTACATCT356230.18440377733975072Illumina PCR Primer Index 11 (100% over 22bp)
TGTAAACATCCTACACTCTCAGCT345890.17905123808788248No Hit
AGCTACATTGTCTGCTGGGTTTC329070.170344302863857No Hit
TTCCCTTTGTCATCCTATGCCT326800.16916922896620312No Hit
ACCATCGACCGTTGACTGTACC325800.16865157526679614No Hit
TGAGGTAGTAGGTTGTATAGTTT315090.1631075041461473No Hit
AGCAGCATTGTACAGGGCTATGA301150.15589141157641392No Hit
AACAGTCAACGCTGTCGGTGAGT295210.1528165486019364No Hit
AACATTCAACGCTGTCGGTGAGTT293410.15188477194300384No Hit
AACATTCATTGCTGTCGGTGGGTT291820.15106170256094673No Hit
ACCGTGGCTTTAGATTGTTACT291790.15104617294996453No Hit
TGCTCAGTAGTCAGTGTAGATCC288050.14911014811418238No Hit
TGAGGTAGTTGGTTGTATTGTT284250.14714306405643585No Hit
GTACAGTACTGTGATAACTGA280960.14543998338538686No Hit
CATTATTACTTTTGGTACGCG275820.14277924337043496No Hit
AACATTCAACGCTGTCGGTGAGA267730.13859142494223245No Hit
ACCCTGTAGAACCGAATTTGCG265520.13744741026654297No Hit
TACAGTACTGTGATAACTGAAG263890.1366036347365096No Hit
TTAGGTAGTAGGTTGTATAGTT261350.13528879434001587No Hit
AAGGTCCAACCTCACATGTCCT261020.13511796861921155No Hit
TAAATCTAGAGAACCGAAAGTA256250.13264876047304025No Hit
CTTTGGTTATCTAGCTGTATGA252200.13055226299044193No Hit
TCCCTGAGACCCTAACTTGTG252120.13051085069448937No Hit
TGAGATGAAGCACTGTAGCT248560.1286680035246005No Hit
AAGCCCTTACCCCAAAAAGCAT245520.12709433627840327No Hit
TTCACAGTGGCTAAGTTCTGCT244800.12672162561483025No Hit
AACATTCAACGCTGTCGGTG242290.1254223148293187No Hit
AACTTTCAACGCTGTCGGTGAG242240.12539643214434837No Hit
AATATTCAACGCTGTCGGTGAG241110.12481148346401846No Hit
TTCACAGTGGTTAAGTTCTG240520.12450606778136833No Hit
TCCCTGAGACCCTTAACCTGTGG235140.12172109087855876No Hit
TAAGGCACGCGGTGAATGCCA231020.11958835763700197No Hit
TGCTCAGTAGTCAGTGTAGATC226210.11709844334285437No Hit
TGAGGTAGTAGATTGAATAGTT222180.11501229893424421No Hit
TAACAGTCTACAGCCATGGTCG220360.1140701692013235No Hit
CCACGTTCCCGTGG217720.11270356343488905No Hit
CAGGCTGGTTAGATGGTTGTCT216200.11191672981179043No Hit
TGAGGTAGTAGGTTGTGTGGTT215790.11170449179503357No Hit
AACTCCAGTCACGGCTACATCTCG213110.11031717988062284Illumina PCR Primer Index 11 (100% over 24bp)
TATGGCTTTTTATTCCTATCTG209610.1085053919326984No Hit
CCTTTCTGAGGGTCGCT202310.1047265199270274No Hit
TAAAGCTAGAGAACCGAAAGTAA201110.10410533548773902No Hit
AACCCGTAGATCCGAACTTGT200340.10370674213919563No Hit
TTACAATTAAAGGATATTTCTT198750.10288367275713853No Hit
AACGTTCAACGCTGTCGGTGAG197950.10246954979761293No Hit
AACTTTCAACGCTGTCGGTGAGT194120.10048693612888418No Hit
TGTAAACATCCCCGACTGGAAGCT193550.10019187352022219No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCATA50.00168364042205.089823
CGTATGC11850.02056.223123
CAACCCG4900.01890.076923
AATAACC4550.01647.759523
TAACTAA2400.01470.059823
CGTATTC400.01378.181223
GATTCCT5750.01342.228523
TAACTGC3650.01298.888723
AACGCAT50.00641674271129.456222
TCGCGAT50.00641674271129.456222
ATAACTA26900.01039.183722
TCGTATG12150.01036.496822
ACAACCC13000.01020.8545522
TCTGACT36000.0888.161223
TAACACC502.6011548E-10882.0359523
ATAAAAA1550.0874.417722
TAATAAC6150.0835.613922
GTATGCC701.8189894E-12787.532123
GATAAAA7150.0756.573521
GATAACA5500.0716.583221