FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_12_JG10_1_GTAGAG_L007_R1_001_TRIMMED_prinseq_good_6PaC.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_12_JG10_1_GTAGAG_L007_R1_001_TRIMMED_prinseq_good_6PaC.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13976652
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG11406308.160967304616298No Hit
AACATTCAACGCTGTCGGTGAGT9837027.038180531360442No Hit
TTCAAGTAATCCAGGATAGGCT8439116.038005382118693No Hit
TCACAGTGAACCGGTCTCTTT5184713.7095507565044907No Hit
TGAGGTAGTAGGTTGTATAGTT3459442.4751564251581852No Hit
AACATTCAACGCTGTCGGTGA2575371.8426229686479996No Hit
CCTGTCTGAGGGTCGCT1988371.4226368374915537No Hit
TCCCTGAGACCCTTAACCTGTG1642401.1751025925235887No Hit
TCTTTGGTTATCTAGCTGTAT1480801.0594811976430407No Hit
TTAAAGGGAATTTGCGACTGTT1300410.9304159536919142No Hit
TTGCATAGTCACAAAAGTGATC1247690.8926959045699928No Hit
AGCTACATCTGGCTACTGGGTCTC1239290.8866858815687763No Hit
TCTTTGGTTATCTAGCTGTATGA1216240.8701940922618664No Hit
TAAAGCTAGAGAACCGAAAGTA1188370.8502536945185442No Hit
TCCCTGAGACCCTTAACCTGTGA1081420.7737332230923399No Hit
TCACAGTGAACCGGTCTCTTTT1068880.7647611173262381No Hit
AAGCTGCCAGCTGAAGAACTGT1042310.745750842190247No Hit
TGAGGTAGTAGTTTGTGCTGTT973690.6966546781017371No Hit
TCACAGTGAACCGGTCTCTT972630.6958962704372978No Hit
TAGCTTATCAGACTGGTGTTGGC898010.6425072327764905No Hit
TTCACAGTGGCTAAGTTCTGC881320.630565889456216No Hit
TATTGCACTCGTCCCGGCCTCC871070.6232322304368743No Hit
TCTTTGGTTATCTAGCTGTATG867750.6208568403935363No Hit
AACATTCATTGCTGTCGGTGGG866560.6200054204683639No Hit
TAACAGTCTACAGTCATGGCT856260.6126359875025865No Hit
AACATTCATTGCTGTCGGTGGGT768860.5501031291327851No Hit
TGAGGTAGTAGTTTGTATAGTT741390.5304489229609495No Hit
CTGTCTGAGGGTCGCT731840.5236160991917092No Hit
TTCACAGTGGCTAAGTTCTG721260.516046332125891No Hit
TCCAGCATCAGTGATTTTGTTG679910.4864612784234737No Hit
AAGCTGCCAGCTGAAGAACT675800.48352066002644983No Hit
CTACGCCTGTCTGAGGGTCGCT668440.4782547351110981No Hit
TCCAGCATCAGTGATTTTGTT653020.4672220500302934No Hit
TCCCTGAGACCCTTAACCTGT646110.46227809063286396No Hit
ACCTTGGCTTTAGACTGCTTACT645380.4617557910149011No Hit
TCCCTGAGACCCTAACTTGTGA626660.4483620254693327No Hit
AGCTGGTGTTGTGAATCAGGCCG620560.4439976040041635No Hit
TTCCCTTTGTCATCCTATGCCTG617670.4419298699001735No Hit
TGAGGTAGTAGGTTGTATAGT592060.4236064545357501No Hit
TAAAGCTAGAGAACCGAAAGT582190.41654467750932056No Hit
AGCTACATCTGGCTACTGGGTCT563860.40342994874595145No Hit
TAAAGGGAATTTGCGACTGTT542630.3882403310893052No Hit
CCCTGAGACCCTTAACCTGTGA529840.37908935559102425No Hit
AACCCGTAGATCCGAACTTGTG526400.3766281080762403No Hit
TCTTTGGTTATCTAGCTGTATGT519480.37167699388952374No Hit
TGAGGTAGTTGGTTGTATAGTT487870.3490607049528027No Hit
TGTCTGAGGGTCGCT471420.3372910765754202No Hit
TATTGCACTTGTCCCGGCCTGT459190.3285407692772203No Hit
AGCTACATTGTCTGCTGGGTTT434170.31063948648073947No Hit
CCACGTTCCCGTGG405640.2902268726444645No Hit
TTCAAGTAATCCAGGATAGGCTT395000.28261417684292345No Hit
TTCAAGTAATCCAGGATAGGC377890.27037233237258823No Hit
TAAGGCACGCGGTGAATGCC360940.2582449645308476No Hit
AGCTACATTGTCTGCTGGGTTTC342050.24472956756739742No Hit
TACCCTGTAGAACCGAATGTGT332010.23754615912308613No Hit
CCTTTCTGAGGGTCGCT329450.23571453306557252No Hit
TAGCAGCACGTAAATATTGGAG318750.22805890852830848No Hit
AACATTCAACGCTGTCGGTGG318660.22799451542472401No Hit
ACCGTGGCTTTAGATTGTTACT312110.2233081284416325No Hit
TTCAAGTAATCCAGGATAGGTT306410.21922989854794983No Hit
ACCATCGACCGTTGACTGTACC297020.21251155140730416No Hit
AAGCTGCCAGTTGAAGAGCTGT296510.21214665715365882No Hit
TGTAAACATCCTTGACTGGAAGCT296000.21178176290001355No Hit
ACCATCGACCGTTGACTGTGCC291100.20827591614930385No Hit
TGAGATGAAGCACTGTAGCTCT290750.20802549852425317No Hit
TTGCATAGTCACAAAAATGAGC279340.19986188394760063No Hit
TTCCCTTTGTCATCCTATGCCT276670.19795155520792818No Hit
GTACAGTACTGTGATAACTGA272700.19511110386092465No Hit
TGTAAACATCCTACACTCTCAGCT263120.18825681572382283No Hit
TGAGGTAGTAGGTTGTATAGTTT262300.1876701230022755No Hit
TAACAGTCTACAGCCATGGTCG256120.18324846322280902No Hit
TGCTCAGTAGTCAGTGTAGATCC255450.18276909234056912No Hit
TGATGTAGTAGGTTGTATAGTT251060.1796281398435047No Hit
AGAATAATGCCAGCAGTCGGTC243170.17398301109593342No Hit
TAGCTTATCAGACTGGTGTTGG239250.17117833369536567No Hit
AGCAGCATTGTACAGGGCTATGA236670.16933239805927772No Hit
TGAGGTAGTAGGTTGTGTGGTT234450.16774403483752762No Hit
AACATTCAACGCTGTCGGTGAGA234020.1674363788981796No Hit
TAAGGCACGCGGTGAATGCCA231680.16576215820498355No Hit
TGAGATGAAGCACTGTAGCTC229360.16410224709036184No Hit
CTTTGGTTATCTAGCTGTATGA226670.1621776087721151No Hit
AACATTCAACGCTGTCGGTGAGTT225560.16138342716124005No Hit
TTATGTAGTAGGTTGTATAGTT223040.15958042026087507No Hit
AAGCCCTTACCCCAAAAAGCAT223020.15956611068230075No Hit
TGCTCAGTAGTCAGTGTAGATC220820.15799205703912497No Hit
CCTTGGCTTTAGACTGCTTACT215250.15400683940617538No Hit
TGAGGTAGTTGGTTGTATTGTT212910.15233261871297935No Hit
TACAGTACTGTGATAACTGAAG212750.15221814208438472No Hit
ATCTACATCTGGCTACTGGGTCTC211240.15113776890202316No Hit
AACATTCAACGCTGTCGGTG206930.1480540547192561No Hit
TCCCTGAGACCCTAACTTGTG196300.14044851370700223No Hit
AAGCTGCCAGCTGAAGAACTGC194450.13912487768887713No Hit
GAGAGAGGCATGATCGTAGCGATAACTA186650.1335441420448903No Hit
AACATTCATTGCTGTCGGTGGGTT185600.13279288916973822No Hit
GAAGGATCATTA184720.13216326771246792No Hit
TAAAGCTAGAGAACCGAAAGTAA183150.13103996579438337No Hit
AATATTCAACGCTGTCGGTGAG182610.1306536071728766No Hit
TCCCTGAGACCCTTAACCTGTGG178710.12786323935088317No Hit
AACAGTCAACGCTGTCGGTGAG178570.1277630723008629No Hit
CTTTTTGCGGTCTGGGCTTGC172550.12345588914999099No Hit
CACCACGTTCCCGTGG170470.12196769297826118No Hit
TGAGGTAGTAGATTGAATAGTT164320.11756749756665617No Hit
TAAATCTAGAGAACCGAAAGTA162030.11592905081989592No Hit
TGAGATGAAGCACTGTAGCT161450.11551407304124048No Hit
AATATTCAACGCTGTCGGTGAGT159190.11389709066234174No Hit
CATTATTACTTTTGGTACGCG158090.11311006384075385No Hit
ACCATTGACCGTTGACTGTACC157790.11289542016213897No Hit
TTCACAGTGGCTAAGTTCTGCT156110.11169341556189565No Hit
TAACAGTCTACAGCCATGGTC155510.1112641282046659No Hit
AACAGTCAACGCTGTCGGTGAGT151110.10811602091831435No Hit
AACCCGTAGATCCGAACTTGT149700.10710719562882441No Hit
TTAGGTAGTAGGTTGTATAGTT149230.10677092053232777No Hit
TACGCCTGTCTGAGGGTCGCT148470.10622715654650342No Hit
TCACAGTGAACCGGTCTCT148290.10609837033933447No Hit
TTACAATTAAAGGATATTTCTT148010.10589803623929393No Hit
CAGGCTGGTTAGATGGTTGTCT146050.10449569753901006No Hit
AAGGTCCAACCTCACATGTCCT146000.10445992359257425No Hit
TCCCTGAGACCCTTAACCTGTGT145900.10438837569970262No Hit
TGAGGTAGTAGTTTGTGCTGTTT145220.10390185002817555No Hit
GAGAGAGGCATGATCGTAGCGATAACTGA141130.10097554120972604No Hit
TTTAAGTAATCCAGGATAGGCT140570.10057487300964493No Hit
TAGCAGCACGGAATGGTTTGT140220.10032445538459425No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATTCCGC50.00101078372845.59923
CAACCCG1100.02457.56323
TAACTAA2550.02399.230523
AATAACC2900.02207.792523
TAACTGC1950.02188.922623
CATGAAA100.0040421891422.799623
CAATACC100.0040421891422.799623
GGCCGAC50.00414941131404.523422
TAACATT50.00414941131404.523422
ATAACTA25700.01360.802922
ACAACCC4700.01344.756522
GATTCCT2050.01318.692423
GGCTCGT1100.01293.454123
GGGAAAA251.4765161E-51138.239623
TAAAAAA900.01106.62223
ATAAAAA2400.01053.392622
TAATAAC4000.0983.1664422
TCTGACT24800.0952.357723
AGATATA50.009073086949.76921
GACGTGG50.009073086949.76921