FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_12_JG11_1_GTCCGC_L008_R1_001_TRIMMED_prinseq_good_DAm1.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_12_JG11_1_GTCCGC_L008_R1_001_TRIMMED_prinseq_good_DAm1.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16466547
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG15178049.217500183857611No Hit
AACATTCAACGCTGTCGGTGAGT12737017.735082528231328No Hit
TTCAAGTAATCCAGGATAGGCT9680545.878913168619991No Hit
TCACAGTGAACCGGTCTCTTT6698664.068041709048047No Hit
TGAGGTAGTAGGTTGTATAGTT3954582.4015842544280837No Hit
AACATTCAACGCTGTCGGTGA3550542.1562140502195146No Hit
CCTGTCTGAGGGTCGCT1994811.2114318806486872No Hit
TCCCTGAGACCCTTAACCTGTG1828941.1107003793812995No Hit
TCTTTGGTTATCTAGCTGTAT1632570.9914464763013155No Hit
TAAAGCTAGAGAACCGAAAGTA1617490.9822885150116778No Hit
TTGCATAGTCACAAAAGTGATC1578420.9585616219356736No Hit
TCTTTGGTTATCTAGCTGTATGA1547790.9399602721809253No Hit
TTAAAGGGAATTTGCGACTGTT1490860.905387146436955No Hit
TCCCTGAGACCCTTAACCTGTGA1415330.8595183920466142No Hit
AGCTACATCTGGCTACTGGGTCTC1415090.8593726419995643No Hit
TCACAGTGAACCGGTCTCTTTT1333720.8099573031310086No Hit
AAGCTGCCAGCTGAAGAACTGT1307000.7937304645594488No Hit
TCACAGTGAACCGGTCTCTT1240320.7532362431540748No Hit
TAGCTTATCAGACTGGTGTTGGC1231440.747843491413227No Hit
AACATTCATTGCTGTCGGTGGG1122760.6818430117741139No Hit
TTCACAGTGGCTAAGTTCTGC1042490.6330956939545371No Hit
TAACAGTCTACAGTCATGGCT1040160.6316807039144273No Hit
AACATTCATTGCTGTCGGTGGGT1003230.6092534154246182No Hit
TATTGCACTCGTCCCGGCCTCC973710.5913261596374759No Hit
TCTTTGGTTATCTAGCTGTATG960630.5833827820732543No Hit
TGAGGTAGTAGTTTGTGCTGTT934050.5672409643624738No Hit
ACCTTGGCTTTAGACTGCTTACT914970.5556538356220039No Hit
TGAGGTAGTAGTTTGTATAGTT910700.5530606993682403No Hit
AAGCTGCCAGCTGAAGAACT825330.5012161930488523No Hit
TCCCTGAGACCCTAACTTGTGA791990.48096908234616526No Hit
CTGTCTGAGGGTCGCT777580.47221800660454194No Hit
TAAAGCTAGAGAACCGAAAGT751480.4563676889878613No Hit
TTCACAGTGGCTAAGTTCTG741330.45020367658137433No Hit
TCCAGCATCAGTGATTTTGTTG740510.4497056972539537No Hit
TCCCTGAGACCCTTAACCTGT709660.43097074328940976No Hit
AACCCGTAGATCCGAACTTGTG692890.4207864587517954No Hit
CCCTGAGACCCTTAACCTGTGA692820.4207439483214058No Hit
AGCTACATCTGGCTACTGGGTCT684540.41571557169818296No Hit
TCCAGCATCAGTGATTTTGTT672880.4086345485790069No Hit
TGAGGTAGTAGGTTGTATAGT641000.3892740839958736No Hit
CTACGCCTGTCTGAGGGTCGCT629140.3820716025041559No Hit
TACCCTGTAGAACCGAATTTGT628690.38179832116593726No Hit
AGCTGGTGTTGTGAATCAGGCCG614640.3732658704948888No Hit
TTCCCTTTGTCATCCTATGCCTG613400.3725128285851308No Hit
TCTTTGGTTATCTAGCTGTATGT613380.3725006827478766No Hit
TAAAGGGAATTTGCGACTGTT544020.3303789191504448No Hit
TGAGGTAGTTGGTTGTATAGTT500790.3041256919255749No Hit
TGTCTGAGGGTCGCT487740.2962005331172346No Hit
TACCCTGTAGAACCGAATGTGT464690.28220245568181357No Hit
TTCAAGTAATCCAGGATAGGC460840.2798643820103875No Hit
TACCCTGTAGATCCGGATTTGT455220.27645140174196814No Hit
TTCAAGTAATCCAGGATAGGTT443860.26955256618160445No Hit
TTCAAGTAATCCAGGATAGGCTT438090.26604849213377885No Hit
AAGCTGCCAGTTGAAGAGCTGT437180.26549585653871455No Hit
TAGCAGCACGTAAATATTGGAG421460.2559492284569437No Hit
AGCTACATTGTCTGCTGGGTTT420700.2554876866412855No Hit
TATTGCACTTGTCCCGGCCTGT406380.24679126716730593No Hit
AACATTCAACGCTGTCGGTGG386510.23472437785529657No Hit
ACCGTGGCTTTAGATTGTTACT358310.21759874732692897No Hit
AGCTACATTGTCTGCTGGGTTTC351080.2132080271595496No Hit
ACCATCGACCGTTGACTGTGCC344680.20932135923821793No Hit
TAAATCTAGAGAACCGAAAGTA341110.20715332728835015No Hit
ACCATCGACCGTTGACTGTACC338600.20562902471295288No Hit
TTGCATAGTCACAAAAATGAGC336950.20462699313948457No Hit
TACCCTGTAGAACCGAATTTGCG335700.20386787831109948No Hit
TGTAAACATCCTTGACTGGAAGCT332850.20213709650238146No Hit
TGAGATGAAGCACTGTAGCTCT316530.19222609330298573No Hit
TGAGGTAGTAGGTTGTATAGTTT311710.18929894652473284No Hit
AGAATAATGCCAGCAGTCGGTC302080.18345072588685413No Hit
CCACGTTCCCGTGG298660.1813737877163925No Hit
ATCTACATCTGGCTACTGGGTCTC297050.18039604781743254No Hit
AACATTCAACGCTGTCGGTGAGA294510.17885352648615402No Hit
TGCTCAGTAGTCAGTGTAGATCC293480.1782280158675647No Hit
TAACAGTCTACAGCCATGGTCG292240.1774749739578067No Hit
TAGCTTATCAGACTGGTGTTGG286990.17428669167858934No Hit
AACATTCAACGCTGTCGGTGAGTT282480.17154780537777592No Hit
AACAGTCAACGCTGTCGGTGAG281110.17071581552586587No Hit
TTCCCTTTGTCATCCTATGCCT277310.1684081064475752No Hit
GTACAGTACTGTGATAACTGA273260.1659485744036075No Hit
TGTAAACATCCTACACTCTCAGCT267720.1625841774842048No Hit
CTTTGGTTATCTAGCTGTATGA266310.16172789595778642No Hit
CCTTTCTGAGGGTCGCT262050.15914083262265002No Hit
AACATTCAACGCTGTCGGTG254950.15482906039742272No Hit
TGATGTAGTAGGTTGTATAGTT249250.1513674967799867No Hit
AACATTCATTGCTGTCGGTGGGTT246500.14969744415753952No Hit
TACCCTGTAGAACCGAATTTGC246340.14960027745950624No Hit
AGCAGCATTGTACAGGGCTATGA240680.14616300551657857No Hit
TGAGGTAGTAGGTTGTGTGGTT238610.14490591136077285No Hit
TGAGATGAAGCACTGTAGCTC236420.14357594218144218No Hit
AACAGTCAACGCTGTCGGTGAGT235990.1433148066804777No Hit
TGCTCAGTAGTCAGTGTAGATC234750.1425617647707197No Hit
CCTTGGCTTTAGACTGCTTACT228840.13897266986211498No Hit
AAGCCCTTACCCCAAAAAGCAT227070.1378977632651217No Hit
AATATTCAACGCTGTCGGTGAG225850.13715686719261785No Hit
TAAAGCTAGAGAACCGAAAGTAA224240.13617912729365786No Hit
TGAGTTAGTAGGTTGTATAGTT223550.13576009590838928No Hit
TCCCTGAGACCCTAACTTGTG216860.1316973133468723No Hit
TACCCTGTAGATCCGGATTTGTG212960.1293288750823108No Hit
TGAGGTAGTTGGTTGTATTGTT212320.12894020829017766No Hit
AAGCTGCCAGCTGAAGAACTGC211840.12864870819607777No Hit
TCCCTGAGACCCTTAACCTGTGG208770.126784322177564No Hit
AAGGTCCAACCTCACATGTCCT207490.12600698859329768No Hit
TTAGGTAGTAGGTTGTATAGTT205510.1248045507051357No Hit
TACAGTACTGTGATAACTGAAG203040.12330453980424676No Hit
TAAGGCACGCGGTGAATGCC195740.11887130920647784No Hit
AACCCGTAGATCCGAACTTGT194990.11841584030944678No Hit
AATATTCAACGCTGTCGGTGAGT189770.11524577678611064No Hit
TAACAGTCTACAGCCATGGTC187160.1136607450244426No Hit
TCACAGTGAACCGGTCTCT182340.11073359824618968No Hit
CATTATTACTTTTGGTACGCG180330.10951294160214647No Hit
GAAGGATCATTA177590.10784896189832635No Hit
TAGCAGCACGGAATGGTTTGT176280.10705340955817877No Hit
TGAGGTAGTAGATTGAATAGTT173380.10529226315632537No Hit
AACATTCAACGCTGTCGGTGT169080.10268090814668067No Hit
TTCACAGTGGCTAAGTTCTGCT168790.10250479350649533No Hit
ACCATCGACCGTTGACTGTGCCT168000.10202503293495595No Hit
CAGGCTGGTTAGATGGTTGTCT166170.10091368882620018No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACCCG1000.03577.226823
TAACTGC2250.03012.401623
AATAACC4100.02938.928523
TAACTAA2000.02918.26423
TAAAAAA1000.02824.126523
ACGCATA301.8189894E-122510.334723
TCGTTTT100.00230852861882.751223
AAGGTTA100.00230852861882.751223
CCACTGC100.00230852861882.751223
ACTACGA100.00230852861882.751223
ACTCCCT100.00230852861882.751223
CGCCGCT100.00230852861882.751223
CCTAGTA50.00263338581763.1222
GCACGAC50.00263338581763.1222
AAAAACC207.2759576E-121763.1222
TCTAACA50.00263338581763.1222
CTAATAG50.00263338581763.1222
ATAACTA23400.01684.005522
ACAACCC5550.01683.700122
ATAAAAA3800.01438.334722