FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_12_JG13_1_GTGAAA_L001_R1_001_TRIMMED_prinseq_good_T6Ct.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_12_JG13_1_GTGAAA_L001_R1_001_TRIMMED_prinseq_good_T6Ct.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15688839
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG13690328.726152394068166No Hit
AACATTCAACGCTGTCGGTGAGT11638687.418445686133945No Hit
TTCAAGTAATCCAGGATAGGCT8471525.39971122146132No Hit
TCACAGTGAACCGGTCTCTTT6246883.9817350410696424No Hit
TGAGGTAGTAGGTTGTATAGTT3774652.4059460359048876No Hit
AACATTCAACGCTGTCGGTGA3016111.9224558299055778No Hit
TCCCTGAGACCCTTAACCTGTG1928021.2289118398117285No Hit
AGCTACATCTGGCTACTGGGTCTC1799221.146815261473459No Hit
CCTGTCTGAGGGTCGCT1723011.0982393279706677No Hit
TCCCTGAGACCCTTAACCTGTGA1383020.881531131781007No Hit
TAAAGCTAGAGAACCGAAAGTA1382070.8809256057761826No Hit
AAGCTGCCAGCTGAAGAACTGT1370520.8735636843491096No Hit
TTAAAGGGAATTTGCGACTGTT1355440.8639517557672687No Hit
TCACAGTGAACCGGTCTCTTTT1223690.7799748598350713No Hit
TAGCTTATCAGACTGGTGTTGGC1211370.7721221436461932No Hit
TCACAGTGAACCGGTCTCTT1207470.7696363000474413No Hit
TTGCATAGTCACAAAAGTGATC1161240.7401694924653124No Hit
AACATTCATTGCTGTCGGTGGG1103460.7033407634561104No Hit
TCTTTGGTTATCTAGCTGTAT1045220.6662188323814145No Hit
TCTTTGGTTATCTAGCTGTATGA1021940.6513802582842491No Hit
TTCACAGTGGCTAAGTTCTGC985050.6278667274232338No Hit
AACATTCATTGCTGTCGGTGGGT965600.6154693792192016No Hit
TATTGCACTCGTCCCGGCCTCC964490.6147618698872491No Hit
TAACAGTCTACAGTCATGGCT916200.5839820269683436No Hit
TGAGGTAGTAGTTTGTGCTGTT900230.5738028161293516No Hit
TGAGGTAGTAGTTTGTATAGTT843370.5375604912511373No Hit
AAGCTGCCAGCTGAAGAACT823250.5247360878647553No Hit
TTCACAGTGGCTAAGTTCTG790450.5038295058034569No Hit
CTGTCTGAGGGTCGCT766330.4884555192388678No Hit
AGCTACATCTGGCTACTGGGTCT765590.48798384635089953No Hit
TTCCCTTTGTCATCCTATGCCTG743050.4736169451417024No Hit
CTACGCCTGTCTGAGGGTCGCT722240.46035273865707976No Hit
ACCTTGGCTTTAGACTGCTTACT720900.4594986282923803No Hit
TCCCTGAGACCCTAACTTGTGA719740.4587592491707003No Hit
TCCAGCATCAGTGATTTTGTTG707470.4509384027715499No Hit
TCCCTGAGACCCTTAACCTGT694310.44255027411524844No Hit
TGAGGTAGTAGGTTGTATAGT658770.4198972275768781No Hit
TAAAGCTAGAGAACCGAAAGT653540.4165636475713722No Hit
TCCAGCATCAGTGATTTTGTT642730.40967339903226746No Hit
TCTTTGGTTATCTAGCTGTATG638340.40687523149418514No Hit
AACCCGTAGATCCGAACTTGTG606470.38656142752181977No Hit
AGCTGGTGTTGTGAATCAGGCCG588920.375375131327436No Hit
CCCTGAGACCCTTAACCTGTGA577600.36815981093310984No Hit
TACCCTGTAGAACCGAATTTGT542130.3455513821003581No Hit
TAAAGGGAATTTGCGACTGTT527860.33645574411210416No Hit
TGAGGTAGTTGGTTGTATAGTT509300.3246256781652231No Hit
TGTCTGAGGGTCGCT498540.31776729941584586No Hit
AGCTACATTGTCTGCTGGGTTT497470.3170852859156755No Hit
TACCCTGTAGAACCGAATGTGT452360.28833236162344456No Hit
TATTGCACTTGTCCCGGCCTGT439010.27982312776617824No Hit
AACATTCAACGCTGTCGGTGG429580.2738124854235549No Hit
TACCCTGTAGATCCGGATTTGT410280.26151074658870554No Hit
AGCTACATTGTCTGCTGGGTTTC407630.2598216477331433No Hit
TTCAAGTAATCCAGGATAGGCTT399050.254352791815889No Hit
TTCAAGTAATCCAGGATAGGC392320.25006311811855547No Hit
TCTTTGGTTATCTAGCTGTATGT383930.24471536740226602No Hit
TTCAAGTAATCCAGGATAGGTT380850.24275218835504653No Hit
ACCGTGGCTTTAGATTGTTACT372450.23739806368081157No Hit
AAGCTGCCAGTTGAAGAGCTGT370630.2362380033347273No Hit
TGATGTAGTAGGTTGTATAGTT370210.23597029710101555No Hit
AGAATAATGCCAGCAGTCGGTC356660.22733358408483892No Hit
TAGCAGCACGTAAATATTGGAG351830.2242549623971538No Hit
CCACGTTCCCGTGG336720.21462391194147634No Hit
ACCATCGACCGTTGACTGTGCC325510.20747870508455085No Hit
ACCATCGACCGTTGACTGTACC322870.20579598018693415No Hit
AACAGTCAACGCTGTCGGTGAG318720.20315078763954425No Hit
TGCTCAGTAGTCAGTGTAGATCC316300.20160828981672896No Hit
TAGCTTATCAGACTGGTGTTGG303750.19360897259510407No Hit
TACCCTGTAGAACCGAATTTGCG303190.19325203095015508No Hit
TGAGATGAAGCACTGTAGCTCT300470.19151831438897424No Hit
TAACAGTCTACAGCCATGGTCG283140.18047224526939182No Hit
TGAGGTAGTAGGTTGTATAGTTT283050.18041487964788216No Hit
AACATTCAACGCTGTCGGTGAGA282920.18033201819459044No Hit
TTCCCTTTGTCATCCTATGCCT280170.17857917975957302No Hit
AACAGTCAACGCTGTCGGTGAGT269780.17195663745418No Hit
TGTAAACATCCTTGACTGGAAGCT266550.16989784903777774No Hit
AACATTCAACGCTGTCGGTGAGTT262980.1676223460512279No Hit
TTGCATAGTCACAAAAATGAGC260770.16621370134526844No Hit
CCTTTCTGAGGGTCGCT259010.16509188474685732No Hit
TCCCTGAGACCCTTAACCTGTGG257450.1640975473073565No Hit
TGAGGTAGTAGGTTGTGTGGTT256430.1634474035969137No Hit
AACATTCAACGCTGTCGGTG248570.1584374726517367No Hit
AGCAGCATTGTACAGGGCTATGA245350.15638505819327997No Hit
TGCTCAGTAGTCAGTGTAGATC244420.1557922801043468No Hit
AACATTCATTGCTGTCGGTGGGTT239170.15244595218294993No Hit
TGAGATGAAGCACTGTAGCTC238490.15201252304265472No Hit
TGTAAACATCCTACACTCTCAGCT238120.15177668659867055No Hit
TTAGGTAGTAGGTTGTATAGTT233580.14888290969140547No Hit
GTACAGTACTGTGATAACTGA228770.14581703591961137No Hit
AAGCTGCCAGCTGAAGAACTGC228450.1456130692653548No Hit
TGAGGTAGTTGGTTGTATTGTT227970.14530711928396994No Hit
AAGCCCTTACCCCAAAAAGCAT227520.14502029117642168No Hit
TCCCTGAGACCCTAACTTGTG226550.14440201725570642No Hit
TACCCTGTAGAACCGAATTTGC217860.13886304780105144No Hit
CTTTGGTTATCTAGCTGTATGA211400.1347454709682469No Hit
ATCTACATCTGGCTACTGGGTCTC207390.13218951383209426No Hit
TACCCTGTAGATCCGGATTTGTG202570.1291172661023547No Hit
AGCTACATCTGGCTACTGGGTCTCT200640.12788709221886974No Hit
AACTTTCAACGCTGTCGGTGAG200370.12771499535434075No Hit
TAAATCTAGAGAACCGAAAGTA199520.12717320892897174No Hit
TAAAGCTAGAGAACCGAAAGTAA194260.12382050704962935No Hit
AATATTCAACGCTGTCGGTGAG191620.12213778215201265No Hit
TCACAGTGAACCGGTCTCT185670.11834527717442954No Hit
AAGGTCCAACCTCACATGTCCT185670.11834527717442954No Hit
GAAGGATCATTA175810.11206055464014895No Hit
TAAGGCACGCGGTGAATGCC175660.1119649452709662No Hit
CAGGCTGGTTAGATGGTTGTCT174670.11133392343435992No Hit
AACTTTCAACGCTGTCGGTGAGT173310.1104670651537695No Hit
CCTTGGCTTTAGACTGCTTACT173140.1103587078686957No Hit
AGCTACATTGTCTGCTGGGTT169740.10819156216721965No Hit
TACAGTACTGTGATAACTGAAG169720.10817881425132861No Hit
TAACAGTCTACAGCCATGGTC168920.10766889761568718No Hit
TTCACAGTGGCTAAGTTCTGCT165770.10566110086284905No Hit
AATATTCAACGCTGTCGGTGAGT164780.10503007902624278No Hit
AACGTTCAACGCTGTCGGTGAG163670.10432256969429032No Hit
CATTATTACTTTTGGTACGCG157760.10055556054848928No Hit
TGAGGTAGTAGATTGAATAGTT157300.10026235848299547No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCCCCAT56.047112E-43678.916523
AGTCACC56.047112E-43678.916523
TAACTAA2000.03402.997823
CAACCCG1600.03334.01823
AATAACC2250.03106.640623
TAACAAA252.3155735E-92207.349923
TAACTGC2100.02014.644823
ACGCATA100.0024184071839.458323
TACAAAT100.0024184071839.458323
CAGGTAC50.00252307811801.23422
CACGCCA50.00252307811801.23422
ATCACTA103.7308855E-61801.23422
AGTGCCG50.00252307811801.23422
CCTCAAT50.00252307811801.23422
GCGTCAA50.00252307811801.23422
GCGTAAC50.00252307811801.23422
TAGTAAA50.00252307811801.23422
ACAACCC4650.01743.129622
ATAACTA20350.01725.998222
TAAAAAA1250.01618.723323