FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_12_JG14_1_GTGGCC_L002_R1_001_TRIMMED_prinseq_good_lMRB.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_12_JG14_1_GTGGCC_L002_R1_001_TRIMMED_prinseq_good_lMRB.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20211456
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG16741808.28332209218376No Hit
AACATTCAACGCTGTCGGTGAGT14317297.083749928753277No Hit
TTCAAGTAATCCAGGATAGGCT12054425.964152211498272No Hit
TCACAGTGAACCGGTCTCTTT9440864.671043986143304No Hit
TGAGGTAGTAGGTTGTATAGTT4607332.2795636296563693No Hit
AACATTCAACGCTGTCGGTGA3980171.969264361756026No Hit
CCTGTCTGAGGGTCGCT2291311.133668944978531No Hit
TCCCTGAGACCCTTAACCTGTG2286101.131091198971514No Hit
AGCTACATCTGGCTACTGGGTCTC2284221.1301610334257959No Hit
TTAAAGGGAATTTGCGACTGTT1841430.9110823089637877No Hit
TCACAGTGAACCGGTCTCTTTT1833740.9072775360666743No Hit
TCACAGTGAACCGGTCTCTT1814430.8977235484667705No Hit
TCTTTGGTTATCTAGCTGTAT1757490.8695514068852833No Hit
TCCCTGAGACCCTTAACCTGTGA1704510.8433385501766919No Hit
AAGCTGCCAGCTGAAGAACTGT1675030.8287527627895783No Hit
TAAAGCTAGAGAACCGAAAGTA1656200.819436264265177No Hit
TAGCTTATCAGACTGGTGTTGGC1635070.808981797253993No Hit
TCTTTGGTTATCTAGCTGTATGA1614450.7987796623855302No Hit
TTGCATAGTCACAAAAGTGATC1541360.7626170029511976No Hit
AACATTCATTGCTGTCGGTGGG1531250.7576148892984257No Hit
TAACAGTCTACAGTCATGGCT1311200.648740991247736No Hit
AACATTCATTGCTGTCGGTGGGT1290700.6385982286481489No Hit
TGAGGTAGTAGTTTGTGCTGTT1224310.6057505208927055No Hit
TTCACAGTGGCTAAGTTCTGC1189490.5885226675406264No Hit
AGCTACATCTGGCTACTGGGTCT1111760.550064280376436No Hit
TCTTTGGTTATCTAGCTGTATG1091480.5400303669364542No Hit
AAGCTGCCAGCTGAAGAACT1082020.5353498530734252No Hit
ACCTTGGCTTTAGACTGCTTACT1057100.5230202119035857No Hit
TATTGCACTCGTCCCGGCCTCC1019530.5044317440564401No Hit
CTGTCTGAGGGTCGCT1017940.5036450614938379No Hit
TGAGGTAGTAGTTTGTATAGTT1016400.5028831173766007No Hit
TTCACAGTGGCTAAGTTCTG950830.4704411201251409No Hit
TTCCCTTTGTCATCCTATGCCTG901770.44616775753315346No Hit
TCCCTGAGACCCTTAACCTGT889830.4402602167800281No Hit
TCCCTGAGACCCTAACTTGTGA875100.4329722707755443No Hit
CTACGCCTGTCTGAGGGTCGCT860010.42550620796443367No Hit
TAAAGCTAGAGAACCGAAAGT857060.4240466396879077No Hit
TCCAGCATCAGTGATTTTGTTG778320.3850885359273473No Hit
AGCTGGTGTTGTGAATCAGGCCG773380.3826443775253005No Hit
AACCCGTAGATCCGAACTTGTG754470.37328829748831555No Hit
TGAGGTAGTAGGTTGTATAGT752790.3724570857240567No Hit
TCCAGCATCAGTGATTTTGTT738180.3652285119884485No Hit
TAAAGGGAATTTGCGACTGTT689880.34133117376600675No Hit
CCCTGAGACCCTTAACCTGTGA681860.3373631271294854No Hit
AGCTACATTGTCTGCTGGGTTT667600.33030772251143115No Hit
TGATGTAGTAGGTTGTATAGTT623610.3085428382794392No Hit
TGTCTGAGGGTCGCT621640.3075681435320642No Hit
TCTTTGGTTATCTAGCTGTATGT619620.30656871033932437No Hit
TGAGGTAGTTGGTTGTATAGTT567780.2809198901850515No Hit
TTCAAGTAATCCAGGATAGGC565350.27971760174031995No Hit
TAGCAGCACGTAAATATTGGAG552360.2732905536345328No Hit
AGCTACATTGTCTGCTGGGTTTC533600.2640086889336424No Hit
TTCAAGTAATCCAGGATAGGCTT527520.26100049397727704No Hit
AACATTCAACGCTGTCGGTGG520740.2576459607858038No Hit
TATTGCACTTGTCCCGGCCTGT493070.2439557051208978No Hit
CCTTTCTGAGGGTCGCT476160.23558916289850668No Hit
TTCAAGTAATCCAGGATAGGTT475090.23505976016769894No Hit
CCACGTTCCCGTGG472860.2339564255044268No Hit
TGCTCAGTAGTCAGTGTAGATCC424270.2099156042988689No Hit
ACCGTGGCTTTAGATTGTTACT417160.20639779736798775No Hit
AGAATAATGCCAGCAGTCGGTC413510.20459189085635393No Hit
AAGCTGCCAGTTGAAGAGCTGT413370.20452262320933234No Hit
AACAGTCAACGCTGTCGGTGAG413270.20447314631860267No Hit
ATCTACATCTGGCTACTGGGTCTC406600.20117303770693212No Hit
TTCCCTTTGTCATCCTATGCCT395910.19588395808792797No Hit
ACCATCGACCGTTGACTGTGCC383510.189748823637446No Hit
TAAATCTAGAGAACCGAAAGTA375230.18565213708502742No Hit
TAACAGTCTACAGCCATGGTCG365560.18086772175146612No Hit
ACCATCGACCGTTGACTGTACC364070.18013051607959366No Hit
AACATTCAACGCTGTCGGTGAGA360140.17818607427391675No Hit
AACAGTCAACGCTGTCGGTGAGT355410.17584581734240223No Hit
TGCTCAGTAGTCAGTGTAGATC351230.17377768330990107No Hit
TGAGATGAAGCACTGTAGCTCT345330.1708585467568492No Hit
TAGCTTATCAGACTGGTGTTGG342190.16930497238793682No Hit
TGAGGTAGTAGGTTGTATAGTTT335140.16581685159149345No Hit
AATATTCAACGCTGTCGGTGAG330660.1636002868868032No Hit
TTGCATAGTCACAAAAATGAGC329390.1629719303745361No Hit
TGTAAACATCCTTGACTGGAAGCT328670.16261569676128232No Hit
AACATTCAACGCTGTCGGTG326680.1616311066357614No Hit
TGTAAACATCCTACACTCTCAGCT325320.1609582209218376No Hit
AACATTCAACGCTGTCGGTGAGTT324260.16043376588010283No Hit
AACATTCATTGCTGTCGGTGGGTT321720.15917705285556863No Hit
TGAGGTAGTAGGTTGTGTGGTT311560.15415020075743183No Hit
TCCCTGAGACCCTTAACCTGTGG295210.146060729123127No Hit
TGAGATGAAGCACTGTAGCTC292030.14448736399792275No Hit
GTACAGTACTGTGATAACTGA291720.1443339856366607No Hit
AAGCTGCCAGCTGAAGAACTGC284860.14093987093260377No Hit
AATATTCAACGCTGTCGGTGAGT281210.13913396442096995No Hit
CTTTGGTTATCTAGCTGTATGA280070.13856992786665148No Hit
CCTTGGCTTTAGACTGCTTACT279200.13813947891730313No Hit
AAGCCCTTACCCCAAAAAGCAT277980.13753586085040087No Hit
AGCAGCATTGTACAGGGCTATGA274720.13592291421261288No Hit
TCACAGTGAACCGGTCTCT272060.13460682891920306No Hit
TCCCTGAGACCCTAACTTGTG271270.13421596148243847No Hit
AGCTACATCTGGCTACTGGGTCTCT262060.12965913984623376No Hit
TTAGGTAGTAGGTTGTATAGTT250010.12369717451330571No Hit
AGCTACATTGTCTGCTGGGTT247200.12230687388380135No Hit
TTTAAGTAATCCAGGATAGGCT245670.12154987745563704No Hit
CATTATTACTTTTGGTACGCG245450.12144102829603172No Hit
TGAGTTAGTAGGTTGTATAGTT241440.11945700497777102No Hit
TGAGGTAGTTGGTTGTATTGTT239090.11829429804562322No Hit
TACCCTGTAGAACCGAATGTGT236030.11678030518929464No Hit
TAACAGTCTACAGCCATGGTC228970.1132872367037783No Hit
TAGCAGCACGGAATGGTTTGT228550.11307943376271358No Hit
TAAAGCTAGAGAACCGAAAGTAA217810.10776561569834456No Hit
TGAGGTAGTAGATTGAATAGTT213100.105435254144976No Hit
CAGGCTGGTTAGATGGTTGTCT207640.10273381591113476No Hit
AACCCGTAGATCCGAACTTGT206350.10209556402072172No Hit
ACCATTGACCGTTGACTGTACC204930.10139299217236007No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AATTTAA55.568455E-43834.058323
AATAACC2850.03565.001723
TAACTAA2200.03136.95723
CAACCCG1600.02875.543723
TAACTGC3000.02875.543723
TAACACC450.02130.032523
TAAAAAA950.02017.925523
ATAACTA25050.01657.925722
ACAACCC6350.01645.539122
AAATAGC357.546987E-91643.167823
TAATAAC4700.01526.114422
ATAAAAA1650.01341.701822
GATTCCT2150.01337.462323
GTTCAAG2750.01324.492923
GAGGACA5850.01310.789223
TCTGACT38050.01289.775323
ATAACAC1100.01288.033722
AGGTAAC150.0050098691278.019523
TCTTATT150.0050098691278.019523
GGGAGCG150.0050098691278.019523