FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_12_JG15_1_CCGTCC_L002_R1_001_TRIMMED_prinseq_good_6epf.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_12_JG15_1_CCGTCC_L002_R1_001_TRIMMED_prinseq_good_6epf.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21767750
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG20077169.223351058331707No Hit
AACATTCAACGCTGTCGGTGAGT17603398.086912979063063No Hit
TTCAAGTAATCCAGGATAGGCT11515005.289935799519932No Hit
TCACAGTGAACCGGTCTCTTT9689924.451502796568318No Hit
AACATTCAACGCTGTCGGTGA5594292.569990008154265No Hit
TGAGGTAGTAGGTTGTATAGTT4010981.8426249842082898No Hit
CCTGTCTGAGGGTCGCT2892971.3290165497123037No Hit
TCCCTGAGACCCTTAACCTGTG2706211.243219901000333No Hit
TTAAAGGGAATTTGCGACTGTT2146380.986036682707216No Hit
AGCTACATCTGGCTACTGGGTCTC2112150.9703115847986126No Hit
TCCCTGAGACCCTTAACCTGTGA1982690.9108382814025335No Hit
TCACAGTGAACCGGTCTCTTTT1871470.8597443465677436No Hit
AAGCTGCCAGCTGAAGAACTGT1865270.8568960962892351No Hit
TCACAGTGAACCGGTCTCTT1819300.8357776986597145No Hit
TCTTTGGTTATCTAGCTGTAT1655350.7604598546014172No Hit
AACATTCATTGCTGTCGGTGGG1649420.7577356410285858No Hit
TCTTTGGTTATCTAGCTGTATGA1617270.7429660851489015No Hit
AACATTCATTGCTGTCGGTGGGT1551460.712733286628154No Hit
TAAAGCTAGAGAACCGAAAGTA1521430.698937648585637No Hit
CTGTCTGAGGGTCGCT1309710.6016744955266392No Hit
TAGCTTATCAGACTGGTGTTGGC1261280.5794259856898393No Hit
TTCCCTTTGTCATCCTATGCCTG1236780.5681708031376692No Hit
TATTGCACTCGTCCCGGCCTCC1201370.5519036188857369No Hit
TGAGGTAGTAGTTTGTGCTGTT1168600.5368492379782017No Hit
TTCACAGTGGCTAAGTTCTGC1155860.5309965430510732No Hit
AAGCTGCCAGCTGAAGAACT1155480.5308219728727132No Hit
CTACGCCTGTCTGAGGGTCGCT1147490.527151405175087No Hit
TCTTTGGTTATCTAGCTGTATG1125280.5169482376451402No Hit
TAACAGTCTACAGTCATGGCT1108430.5092074284204844No Hit
ACCTTGGCTTTAGACTGCTTACT1107550.5088031606390186No Hit
TCCCTGAGACCCTAACTTGTGA1053530.48398663159949923No Hit
TCCCTGAGACCCTTAACCTGT1029560.47297492850662104No Hit
AGCTACATCTGGCTACTGGGTCT964220.4429580457327928No Hit
TGAGGTAGTAGTTTGTATAGTT954370.4384330029516142No Hit
TTCACAGTGGCTAAGTTCTG934380.4292496927794559No Hit
CCCTGAGACCCTTAACCTGTGA912020.41897761596857735No Hit
TTGCATAGTCACAAAAGTGATC833130.38273592815058977No Hit
AGCTGGTGTTGTGAATCAGGCCG831440.38195955025209316No Hit
TAAAGGGAATTTGCGACTGTT804000.36935374579366265No Hit
TCCAGCATCAGTGATTTTGTTG792900.36425445900472025No Hit
TGAGGTAGTAGGTTGTATAGT746470.3429247395803425No Hit
TGTCTGAGGGTCGCT745290.34238265323701345No Hit
AACCCGTAGATCCGAACTTGTG740710.34027862319256696No Hit
TCCAGCATCAGTGATTTTGTT687970.3160501200169976No Hit
TAAAGCTAGAGAACCGAAAGT687920.31602715025668704No Hit
CCACGTTCCCGTGG655710.30123003066463No Hit
TATTGCACTTGTCCCGGCCTGT653120.30004019708054347No Hit
TGAGGTAGTTGGTTGTATAGTT646860.2971643830896624No Hit
TCTTTGGTTATCTAGCTGTATGT622060.28577138197562907No Hit
TACCCTGTAGAACCGAATGTGT615630.2828174707996922No Hit
CCTTTCTGAGGGTCGCT604660.27777790538755726No Hit
AGCTACATTGTCTGCTGGGTTT572880.26317832573417094No Hit
TGATGTAGTAGGTTGTATAGTT562190.25826739097977514No Hit
TTCAAGTAATCCAGGATAGGCTT550230.2527730243134913No Hit
ACCATCGACCGTTGACTGTACC537700.24701680237966717No Hit
TTCAAGTAATCCAGGATAGGC527860.24249635355055071No Hit
AAGCTGCCAGTTGAAGAGCTGT494630.2272306508481584No Hit
TAGCAGCACGTAAATATTGGAG493540.22672991007338839No Hit
ACCATCGACCGTTGACTGTGCC475180.21829541408735398No Hit
AACATTCAACGCTGTCGGTGAGA472780.21719286559244755No Hit
TTCAAGTAATCCAGGATAGGTT458630.21069242342456157No Hit
AACATTCAACGCTGTCGGTGG458530.21064648390394045No Hit
AACAGTCAACGCTGTCGGTGAG447900.20576311286191729No Hit
TACCCTGTAGAACCGAATTTGT446800.20525777813508514No Hit
TAACAGTCTACAGCCATGGTCG439280.2018031261843783No Hit
AGCTACATTGTCTGCTGGGTTTC426460.19591367964075296No Hit
TACCCTGTAGATCCGGATTTGT424440.1949857013242067No Hit
AACATTCAACGCTGTCGGTG419820.19286329547151176No Hit
AACATTCAACGCTGTCGGTGAGTT407590.18724489209955092No Hit
AATATTCAACGCTGTCGGTGAG406510.18674874527684304No Hit
ACCGTGGCTTTAGATTGTTACT404300.18573348187111668No Hit
AGAATAATGCCAGCAGTCGGTC403370.18530624432934042No Hit
ATCTACATCTGGCTACTGGGTCTC396480.18214101135854646No Hit
TTCCCTTTGTCATCCTATGCCT388840.17863123198309425No Hit
TAGCTTATCAGACTGGTGTTGG377380.17336656291991592No Hit
AACAGTCAACGCTGTCGGTGAGT376980.1731828048374315No Hit
TGTAAACATCCTACACTCTCAGCT359420.16511582501636596No Hit
AATATTCAACGCTGTCGGTGAGT356550.1637973607745403No Hit
AACATTCATTGCTGTCGGTGGGTT356500.16377439101422975No Hit
TAAATCTAGAGAACCGAAAGTA354850.16301638892398157No Hit
TGCTCAGTAGTCAGTGTAGATCC348680.16018192050165958No Hit
AAGCCCTTACCCCAAAAAGCAT342890.15752202225769774No Hit
TGAGATGAAGCACTGTAGCTCT337960.1552572038910774No Hit
AAGCTGCCAGCTGAAGAACTGC323920.14880729519587463No Hit
TGAGGTAGTAGGTTGTGTGGTT313620.1440755245719011No Hit
TACCCTGTAGAACCGAATTTGCG310950.14284893937131768No Hit
AGCAGCATTGTACAGGGCTATGA302380.13891192245408918No Hit
TCCCTGAGACCCTAACTTGTG302020.13874654017985322No Hit
CTTTGGTTATCTAGCTGTATGA299410.13754751869164245No Hit
TGAGGTAGTTGGTTGTATTGTT285940.13135946526397999No Hit
TTGCATAGTCACAAAAATGAGC283580.13027529257732196No Hit
TGAGGTAGTAGGTTGTATAGTTT281160.12916355617829128No Hit
TGTAAACATCCTTGACTGGAAGCT280170.12870875492414238No Hit
ACCATTGACCGTTGACTGTACC278490.12793697097770784No Hit
TGCTCAGTAGTCAGTGTAGATC275980.1267838890101182No Hit
CCTTGGCTTTAGACTGCTTACT272300.1250933146512616No Hit
TGAGATGAAGCACTGTAGCTC267300.1227963386202065No Hit
CTACTCCTGTCTGAGGGTCGCT261720.12023291336954899No Hit
TCACAGTGAACCGGTCTCT260050.11946572337517658No Hit
ACCACGTTCCCGTGG255900.11755923326940082No Hit
AACATTCATTGCTGTCGCTGGGT254260.11680582513121475No Hit
GAAGGATCATTA253110.11627752064407208No Hit
TAACAGTCTACAGCCATGGTC253050.11624995693169941No Hit
GTACAGTACTGTGATAACTGA247030.11348439779030906No Hit
CACCACGTTCCCGTGG239160.10986895751742831No Hit
TTTAAGTAATCCAGGATAGGCT234750.1078430246580377No Hit
CTTTTTGCGGTCTGGGCTTGC231970.10656590598477104No Hit
AACATTCAACGCTGTCGGTGT229140.10526581755119385No Hit
TACCCTGTAGAACCGAATTTGC228620.10502693204396411No Hit
TCCCTGAGACCCTTAACCTGTGT228290.10487533162591449No Hit
TTAGGTAGTAGGTTGTATAGTT224860.10329960606861067No Hit
TACCCTGTAGATCCGGATTTGTG222070.10201789344328191No Hit
TACGCCTGTCTGAGGGTCGCT219410.10079590219476059No Hit
CAGGCTGGTTAGATGGTTGTCT219340.10076374453032583No Hit
TCCCTGAGACCCTTAACCTGTGG218200.10024003399524525No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGCATT55.995571E-43695.072823
TATTCCC55.995571E-43695.072823
CAACCCG2450.03167.205323
AATAACC3000.03140.812323
TAACTAA1900.02819.924323
TAAAAAA700.02111.470523
TAACTGC2550.02101.1223
GAGCGTA100.00239779641847.536423
AGGTTAA100.00239779641847.536423
ATAAGTA50.00276303761721.324622
CGTACCA50.00276303761721.324622
ACGTATT50.00276303761721.324622
ATAACTA26100.01625.695622
ACAACCC8050.01625.101622
TAATAAC4400.01447.477522
GATTCCT1900.01264.10423
CTTAAGT150.0053940691231.69123
AGCCCCT150.0053940691231.69123
GGTCACA301.165789E-51231.69123
GGAAAAA301.165789E-51231.69123