FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_14_JG66_1_GAGTGG_L001_R1_001_TRIMMED_prinseq_good_iyya.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_14_JG66_1_GAGTGG_L001_R1_001_TRIMMED_prinseq_good_iyya.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21252536
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG17032088.014140053685828No Hit
AACATTCAACGCTGTCGGTGAGT13246866.233072608370126No Hit
TTCAAGTAATCCAGGATAGGCT12722135.98617030927509No Hit
TCACAGTGAACCGGTCTCTTT9087864.2761296816530505No Hit
TGAGGTAGTAGGTTGTATAGTT4843872.279196233334224No Hit
AACATTCAACGCTGTCGGTGA3885091.8280594842893103No Hit
TTGCATAGTCACAAAAGTGATC2604391.2254490475866033No Hit
TAAAGCTAGAGAACCGAAAGTA2299241.081866182934592No Hit
TCCCTGAGACCCTTAACCTGTG2238111.0531025567960455No Hit
AGCTACATCTGGCTACTGGGTCTC1995190.9388009035721666No Hit
TTAAAGGGAATTTGCGACTGTT1893490.8909477908895201No Hit
TAGCTTATCAGACTGGTGTTGGC1807770.8506137808683161No Hit
TCACAGTGAACCGGTCTCTTTT1774360.8348933040273405No Hit
AAGCTGCCAGCTGAAGAACTGT1753340.8250027196754307No Hit
CCTGTCTGAGGGTCGCT1701960.8008267813309433No Hit
TCACAGTGAACCGGTCTCTT1687220.793891138450489No Hit
TCCCTGAGACCCTTAACCTGTGA1665380.7836147177917967No Hit
TAACAGTCTACAGTCATGGCT1530610.720201109175865No Hit
TCTTTGGTTATCTAGCTGTAT1501610.7065556788140483No Hit
AACATTCATTGCTGTCGGTGGG1474170.6936442784992812No Hit
TTCACAGTGGCTAAGTTCTGC1456960.6855464213776652No Hit
TACCCTGTAGAACCGAATTTGT1420960.668607266445755No Hit
TCTTTGGTTATCTAGCTGTATGA1342400.6316422661276754No Hit
TACCCTGTAGAACCGAATGTGT1335480.628386184124097No Hit
AACATTCATTGCTGTCGGTGGGT1201630.5654054650230919No Hit
TTCACAGTGGCTAAGTTCTG1195220.562389354381049No Hit
AAGCTGCCAGCTGAAGAACT1190780.5603001919394467No Hit
TGAGGTAGTAGTTTGTGCTGTT1139970.5363924568813812No Hit
TATTGCACTCGTCCCGGCCTCC1115700.524972643264785No Hit
AGCTACATCTGGCTACTGGGTCT1115480.5248691262068678No Hit
TGAGGTAGTAGTTTGTATAGTT1107340.5210389950639303No Hit
TAAAGCTAGAGAACCGAAAGT1062750.5000579695524336No Hit
TCCAGCATCAGTGATTTTGTTG1022910.48131197142778626No Hit
ACCTTGGCTTTAGACTGCTTACT986130.4640058014723513No Hit
AACCCGTAGATCCGAACTTGTG957590.4505768158679981No Hit
TCCAGCATCAGTGATTTTGTT938550.4416178850373433No Hit
TCCCTGAGACCCTAACTTGTGA902370.4245940343307735No Hit
TCTTTGGTTATCTAGCTGTATG881860.41494342134039913No Hit
TTCCCTTTGTCATCCTATGCCTG881390.41472227126212136No Hit
TCCCTGAGACCCTTAACCTGT828100.3896476166420798No Hit
TACCCTGTAGATCCGGATTTGT826410.38885241742444293No Hit
TAAAGGGAATTTGCGACTGTT754810.35516232039319917No Hit
CTGTCTGAGGGTCGCT730380.34366722164357233No Hit
TGAGGTAGTAGGTTGTATAGT725130.3411969282160021No Hit
CTACGCCTGTCTGAGGGTCGCT710580.33435068643102167No Hit
CCCTGAGACCCTTAACCTGTGA700930.32981005184510687No Hit
AGCTGGTGTTGTGAATCAGGCCG692150.32567878017004653No Hit
AGCTACATTGTCTGCTGGGTTT677400.31873843196877777No Hit
TGAGGTAGTTGGTTGTATAGTT627040.29504243634736105No Hit
TTCAAGTAATCCAGGATAGGC615060.2894054620116865No Hit
TTCAAGTAATCCAGGATAGGTT597170.28098764307469004No Hit
TACCCTGTAGAACCGAATTTGCG589000.27714339596930926No Hit
AAGCTGCCAGTTGAAGAGCTGT587490.2764328925263319No Hit
TTCAAGTAATCCAGGATAGGCTT526200.24759398125475474No Hit
TATTGCACTTGTCCCGGCCTGT521310.24529307937650358No Hit
TCTTTGGTTATCTAGCTGTATGT521110.2451989729602152No Hit
AGCTACATTGTCTGCTGGGTTTC515170.24240401239645No Hit
TGTAAACATCCTTGACTGGAAGCT510030.23998547749783838No Hit
TTGCATAGTCACAAAAATGAGC505120.23767516497795838No Hit
TGTCTGAGGGTCGCT489330.23024546341199No Hit
AGAATAATGCCAGCAGTCGGTC482450.22700820269166938No Hit
TAGCAGCACGTAAATATTGGAG479360.22555425856001377No Hit
TGCTCAGTAGTCAGTGTAGATCC473530.22281105652520714No Hit
TGATGTAGTAGGTTGTATAGTT472980.22255226388041408No Hit
TGAGATGAAGCACTGTAGCTCT451260.2123323070714949No Hit
TACCCTGTAGAACCGAATTTGC449080.21130654713395147No Hit
AACATTCAACGCTGTCGGTGG416020.19575075652148052No Hit
TAGCTTATCAGACTGGTGTTGG414360.19496967326628692No Hit
AACAGTCAACGCTGTCGGTGAG410620.193209883281694No Hit
ACCGTGGCTTTAGATTGTTACT410190.19300755448667398No Hit
TGCTCAGTAGTCAGTGTAGATC407840.19190180409528537No Hit
AACTCCAGTCACGAGTGGATCT391410.18417096199719413RNA PCR Primer, Index 23 (100% over 22bp)
TGAGATGAAGCACTGTAGCTC383300.18035494681669992No Hit
TACCCTGTAGATCCGGATTTGTG379040.17835048014975718No Hit
TTCCCTTTGTCATCCTATGCCT372690.1753626014326008No Hit
ACCATCGACCGTTGACTGTGCC363930.17124074039916928No Hit
GTACAGTACTGTGATAACTGA342400.1611101846857241No Hit
AGCAGCATTGTACAGGGCTATGA339400.15969858844139823No Hit
TAAATCTAGAGAACCGAAAGTA337670.15888456794050368No Hit
TGAGGTAGTAGGTTGTATAGTTT329230.15491327717313358No Hit
ACCATCGACCGTTGACTGTACC325430.1531252552636542No Hit
CTTTGGTTATCTAGCTGTATGA323520.15222653898810007No Hit
AACATTCAACGCTGTCGGTGAGA322590.15178894415235905No Hit
AACAGTCAACGCTGTCGGTGAGT313860.1476811990813708No Hit
CATTATTACTTTTGGTACGCG311030.1463495932908901No Hit
TAACAGTCTACAGCCATGGTCG306610.14426984149091665No Hit
TGTAAACATCCTACACTCTCAGCT303170.14265121113075635No Hit
TACAGTACTGTGATAACTGAAG293830.13825644149008853No Hit
TTAGGTAGTAGGTTGTATAGTT293820.1382517361692741No Hit
TAAAGCTAGAGAACCGAAAGTAA293110.13791765839145032No Hit
AACATTCATTGCTGTCGGTGGGTT290940.1368966037747213No Hit
TTACAATTAAAGGATATTTCTT289450.13619551097337276No Hit
TACCCTGTAGAACCGAATGTGTG288250.13563087247564246No Hit
AACATTCAACGCTGTCGGTGAGTT286400.13476038812497482No Hit
AAGCTGCCAGCTGAAGAACTGC286250.13468980831275854No Hit
TGAGGTAGTTGGTTGTATTGTT282470.13291119704490795No Hit
AAGCCCTTACCCCAAAAAGCAT278590.13108553256891317No Hit
AAGGTCCAACCTCACATGTCCT277770.1306996962621308No Hit
AACATTCAACGCTGTCGGTG276550.1301256471227716No Hit
TGAGGTAGTAGGTTGTGTGGTT269520.1268178065902347No Hit
TCACAGTGAACCGGTCTCT268110.12615435635540154No Hit
CCACGTTCCCGTGG261010.12281357857716367No Hit
AACTCCAGTCACGAGTGGATCTCG259750.12222070815454682RNA PCR Primer, Index 23 (100% over 24bp)
TCCCTGAGACCCTAACTTGTG259180.12195250486812491No Hit
AACTTTCAACGCTGTCGGTGAG255400.12017389360027433No Hit
CCTTTCTGAGGGTCGCT254230.11962337106498726No Hit
TCCCTGAGACCCTTAACCTGTGG250060.11766125228537432No Hit
TAAGGCACGCGGTGAATGCC249560.11742598624465335No Hit
TGAGATGAAGCACTGTAGCT249070.1171954255247468No Hit
TTCACAGTGGTTAAGTTCTG244630.11510626308314452No Hit
AATATTCAACGCTGTCGGTGAG243190.11442869688586813No Hit
TGAGGTAGTAGATTGAATAGTT238880.1124007036148533No Hit
AGCTACATCTGGCTACTGGGTCTCT236310.1111914361655475No Hit
TAACAGTCTACAGCCATGGTC233780.11000098999949935No Hit
AGCTACATTGTCTGCTGGGTT232790.10953516323887183No Hit
ATCTACATCTGGCTACTGGGTCTC230400.10841059156422556No Hit
AACCCGTAGATCCGAACTTGT230370.1083964756017823No Hit
CAGGCTGGTTAGATGGTTGTCT229100.10779889985835102No Hit
CCTTGGCTTTAGACTGCTTACT222320.10460869234617459No Hit
TAGCAGCACGGAATGGTTTGT217710.10243953945072719No Hit
TTCACAGTGGCTAAGTTCTGCT215490.10139495822992606No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATTC250.03469.057923
CGTATGC15350.03401.258823
CAACCCG2350.02804.770323
AATAACC4250.02734.433823
TAACTAA2050.02199.890423
ACGCATA252.93403E-92081.434823
TCGTATG16150.01740.851722
TCGGATA204.176047E-61734.528923
ACAACCC8300.01715.799222
ATAACTA19950.01630.321422
TCTGACT37650.01511.090223
TAATAAC5750.01406.137222
ATAAAAA1700.01405.197322
TAACTGC3600.01397.259423
ATTAGCC50.0051766711257.517221
CGACGCA50.0051766711257.517221
CCCGGGA50.0051766711257.517221
GATTCCT2900.01196.226823
GATAAAA5350.01187.002221
CGTATCC453.0766387E-81156.352723