FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_14_JG69_1_GGTAGC_L002_R1_001_TRIMMED_prinseq_good_OcOt.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_14_JG69_1_GGTAGC_L002_R1_001_TRIMMED_prinseq_good_OcOt.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22464782
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG15360496.837586939414769No Hit
AACATTCAACGCTGTCGGTGAGT13122125.841196233286395No Hit
TTCAAGTAATCCAGGATAGGCT12666375.63832313173571No Hit
TCACAGTGAACCGGTCTCTTT10156664.521147812607307No Hit
TGAGGTAGTAGGTTGTATAGTT4838292.153722212839635No Hit
AACATTCAACGCTGTCGGTGA4096481.8235120198362038No Hit
AGCTACATCTGGCTACTGGGTCTC2384941.0616350517000344No Hit
TCCCTGAGACCCTTAACCTGTG2303731.0254851349102787No Hit
CCTGTCTGAGGGTCGCT2264641.0080845654322397No Hit
TAGCTTATCAGACTGGTGTTGGC2216600.9866999822210605No Hit
TTGCATAGTCACAAAAGTGATC2159270.9611800372690018No Hit
TTAAAGGGAATTTGCGACTGTT2078580.9252615939028476No Hit
TAAAGCTAGAGAACCGAAAGTA2032660.9048207100340435No Hit
TCACAGTGAACCGGTCTCTTTT2023250.9006319313492559No Hit
TCTTTGGTTATCTAGCTGTAT1981610.8820962518131714No Hit
AAGCTGCCAGCTGAAGAACTGT1981320.8819671608653937No Hit
TCACAGTGAACCGGTCTCTT1935620.8616242080604211No Hit
TCCCTGAGACCCTTAACCTGTGA1772520.7890216784654309No Hit
TCTTTGGTTATCTAGCTGTATGA1746320.7773589790455122No Hit
TAACAGTCTACAGTCATGGCT1564990.6966415253884948No Hit
TTCACAGTGGCTAAGTTCTGC1537310.6843200169937104No Hit
AACATTCATTGCTGTCGGTGGG1387840.6177847619442736No Hit
TTCACAGTGGCTAAGTTCTG1336190.5947932190038613No Hit
AACATTCATTGCTGTCGGTGGGT1241780.5527674383842229No Hit
AGCTACATCTGGCTACTGGGTCT1182380.5263260511497507No Hit
TGAGGTAGTAGTTTGTGCTGTT1178750.5247101885965331No Hit
TCTTTGGTTATCTAGCTGTATG1176880.5238777745539663No Hit
TACCCTGTAGAACCGAATGTGT1167070.5195109393894853No Hit
ACCTTGGCTTTAGACTGCTTACT1153280.5133724422520548No Hit
TCCAGCATCAGTGATTTTGTTG1146170.5102074883255043No Hit
AAGCTGCCAGCTGAAGAACT1115890.49672861281271286No Hit
TATTGCACTCGTCCCGGCCTCC1084580.4827912418647108No Hit
TCCAGCATCAGTGATTTTGTT1062910.47314503207731995No Hit
TGAGGTAGTAGTTTGTATAGTT1011850.45041612244445556No Hit
CTGTCTGAGGGTCGCT1002350.4461872810517369No Hit
TTCCCTTTGTCATCCTATGCCTG991720.44145543010388444No Hit
AACCCGTAGATCCGAACTTGTG972270.4327974337787921No Hit
TCCCTGAGACCCTAACTTGTGA912980.40640501207623564No Hit
TCCCTGAGACCCTTAACCTGT910290.4052075822502974No Hit
TAAAGCTAGAGAACCGAAAGT890910.3965807458091514No Hit
CTACGCCTGTCTGAGGGTCGCT828310.3687149067371319No Hit
AGCTGGTGTTGTGAATCAGGCCG800970.356544746350087No Hit
TAAAGGGAATTTGCGACTGTT792800.352907942752349No Hit
TGAGGTAGTAGGTTGTATAGT759330.33800906681400245No Hit
AGCTACATTGTCTGCTGGGTTT747010.33252492723944527No Hit
CCCTGAGACCCTTAACCTGTGA735000.32717878143665047No Hit
TACCCTGTAGAACCGAATTTGT707540.31495520410569755No Hit
TCTTTGGTTATCTAGCTGTATGT677070.3013917517650516No Hit
TGATGTAGTAGGTTGTATAGTT653560.29092648217107114No Hit
AAGCTGCCAGTTGAAGAGCTGT637960.28398227946302795No Hit
TACCCTGTAGATCCGGATTTGT630650.2807282972966308No Hit
CCACGTTCCCGTGG629500.2802163849175122No Hit
TATTGCACTTGTCCCGGCCTGT620110.27603650905670934No Hit
TTCAAGTAATCCAGGATAGGC618740.27542666561375934No Hit
TTCAAGTAATCCAGGATAGGTT608800.27100196209337796No Hit
TGTCTGAGGGTCGCT608350.2708016485537229No Hit
AACTCCAGTCACGGTAGCATCT595550.2651038412035336RNA PCR Primer, Index 24 (100% over 22bp)
TTCAAGTAATCCAGGATAGGCTT592310.26366158371801696No Hit
TGAGGTAGTTGGTTGTATAGTT586940.26127117547813283No Hit
AGCTACATTGTCTGCTGGGTTTC584830.2603319275477501No Hit
TAGCAGCACGTAAATATTGGAG558290.24851788012009196No Hit
AACATTCAACGCTGTCGGTGG548500.24415994777959565No Hit
TGCTCAGTAGTCAGTGTAGATCC541620.2410973763288689No Hit
TTGCATAGTCACAAAAATGAGC501860.22339856224734342No Hit
TGTAAACATCCTTGACTGGAAGCT483620.21527918677332367No Hit
CCTTTCTGAGGGTCGCT468820.20869109702466734No Hit
ACCATCGACCGTTGACTGTGCC460320.20490739683118225No Hit
ACCGTGGCTTTAGATTGTTACT460240.20487178553524357No Hit
TGCTCAGTAGTCAGTGTAGATC459320.20446225563194872No Hit
TAAATCTAGAGAACCGAAAGTA455970.20297103261451635No Hit
AGAATAATGCCAGCAGTCGGTC446210.198626454509997No Hit
TAGCTTATCAGACTGGTGTTGG432140.19236331783678115No Hit
ATCTACATCTGGCTACTGGGTCTC421420.1875914041809976No Hit
TGAGATGAAGCACTGTAGCTCT409140.18212507025440977No Hit
TAACAGTCTACAGCCATGGTCG386490.17204262209177013No Hit
AACTCCAGTCACGGTAGCATCTCG381070.16962995679192436RNA PCR Primer, Index 24 (100% over 24bp)
TACCCTGTAGAACCGAATTTGCG376470.1675823072754501No Hit
AACAGTCAACGCTGTCGGTGAG371410.16532989280732838No Hit
AACATTCAACGCTGTCGGTGAGA368180.16389208673380404No Hit
ACCATCGACCGTTGACTGTACC362630.16142155307805792No Hit
GTACAGTACTGTGATAACTGA356770.1588130256505494No Hit
TGAGGTAGTAGGTTGTATAGTTT356300.15860380928690962No Hit
TTCCCTTTGTCATCCTATGCCT354250.15769126982848086No Hit
TGTAAACATCCTACACTCTCAGCT339450.15110318007982448No Hit
TGAGATGAAGCACTGTAGCTC332450.14798719168518973No Hit
AACATTCAACGCTGTCGGTG318280.1416795408920505No Hit
CTTTGGTTATCTAGCTGTATGA316700.14097621779726152No Hit
TCCCTGAGACCCTTAACCTGTGG316600.14093170367733818No Hit
AACATTCATTGCTGTCGGTGGGTT311430.13863032367730077No Hit
AAGCTGCCAGCTGAAGAACTGC311320.13858135814538508No Hit
AACATTCAACGCTGTCGGTGAGTT310300.13812731412216686No Hit
AACAGTCAACGCTGTCGGTGAGT309710.13786468081461906No Hit
TACCCTGTAGATCCGGATTTGTG308640.1373883797314392No Hit
AGCAGCATTGTACAGGGCTATGA306400.13639126344515606No Hit
CATTATTACTTTTGGTACGCG301460.1341922659209424No Hit
CCTTGGCTTTAGACTGCTTACT299950.13352010271009976No Hit
TACCCTGTAGAACCGAATTTGC296200.13185082321297398No Hit
TCACAGTGAACCGGTCTCT294740.13120091706209303No Hit
AATATTCAACGCTGTCGGTGAG291100.12958060309688293No Hit
AACTCCAGTCACGGTAGCATCTCGTATGC289350.12880160599822424RNA PCR Primer, Index 24 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTAA277010.12330856359968238No Hit
TCCCTGAGACCCTAACTTGTG273260.12163928410255662No Hit
AAGCCCTTACCCCAAAAAGCAT271760.12097157230370631No Hit
AGCTACATCTGGCTACTGGGTCTCT270400.12036618027274869No Hit
TACAGTACTGTGATAACTGAAG269740.12007238708125456No Hit
TAAGGCACGCGGTGAATGCC267870.11923997303868784No Hit
AGCTACATTGTCTGCTGGGTT267180.1189328256112167No Hit
TTCACAGTGGCTAAGTTCTGCT266480.11862122677175323No Hit
TGAGGTAGTTGGTTGTATTGTT266290.11853664994389887No Hit
TGAGGTAGTAGGTTGTGTGGTT262950.11704987833845884No Hit
TTACAATTAAAGGATATTTCTT261280.11630649253573883No Hit
TTAGGTAGTAGGTTGTATAGTT258610.11511796553378528No Hit
AACTCCAGTCACGGTAGCATCTC251760.11206874831903556RNA PCR Primer, Index 24 (100% over 23bp)
TGAGTTAGTAGGTTGTATAGTT251080.11176605230355674No Hit
CAGGCTGGTTAGATGGTTGTCT250500.11150787040800128No Hit
AATATTCAACGCTGTCGGTGAGT250310.11142329358014692No Hit
AACCCGTAGATCCGAACTTGT247580.11020805810623936No Hit
TTCACAGTGGTTAAGTTCTG246530.10974065984704413No Hit
TCCATCATCAGTGATTTTGTTG243510.10839633342535887No Hit
TTTAAGTAATCCAGGATAGGCT242350.10787996963424797No Hit
TACCCTGTAGAACCGAATGTGTG237730.10582341729378901No Hit
GAAGGATCATTA230740.10271188031114659No Hit
TGAGGTAGTAGATTGAATAGTT227060.10107376069796717No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC30650.02199.877223
CAACCCG1850.01981.446823
GATTCCT27350.01770.799323
AATAACC3300.01750.36923
TAACTAA2500.01732.865423
AATGGGG50.00460325461333.561222
GAGACGT50.00460325461333.561222
TAACTGC2350.01323.519523
TCGTATG32050.01298.193722
ACAACCC7000.01257.357722
ATAACTA22600.01224.397822
CGTATCC950.01169.274923
ATTCGGC15100.01118.167523
CGTATTC600.01110.81123
CGCGGCG100.0066330361110.81123
ATAAAAA2100.01079.549422
GGATTCC32050.01077.667222
TAATAAC4700.0993.077422
CAAGGCG50.009046892951.1824321
AAGATAC50.009046892951.1824321