FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_14_JG70_1_ACTGAT_L007_R1_001_TRIMMED_prinseq_good_eWIj.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_14_JG70_1_ACTGAT_L007_R1_001_TRIMMED_prinseq_good_eWIj.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20509255
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG15988627.795807307481427No Hit
AACATTCAACGCTGTCGGTGAGT13527376.595739338167086No Hit
TTCAAGTAATCCAGGATAGGCT12318446.0062835046909315No Hit
TCACAGTGAACCGGTCTCTTT8663504.224190493511344No Hit
TGAGGTAGTAGGTTGTATAGTT4878282.378574940923013No Hit
AACATTCAACGCTGTCGGTGA4298272.0957709092797376No Hit
TTGCATAGTCACAAAAGTGATC2289891.1165154463192348No Hit
AGCTACATCTGGCTACTGGGTCTC2252211.098143252887538No Hit
CCTGTCTGAGGGTCGCT2252121.0980993702599144No Hit
TAGCTTATCAGACTGGTGTTGGC2100591.0242156528845148No Hit
TAAAGCTAGAGAACCGAAAGTA1996620.9735214662843676No Hit
TCCCTGAGACCCTTAACCTGTG1996370.9733995700965247No Hit
TCTTTGGTTATCTAGCTGTAT1886310.9197359923605221No Hit
AAGCTGCCAGCTGAAGAACTGT1867660.9106425367474342No Hit
TTAAAGGGAATTTGCGACTGTT1773330.8646486671505133No Hit
TCACAGTGAACCGGTCTCTT1689880.8239597196485196No Hit
TCTTTGGTTATCTAGCTGTATGA1681920.8200785450275985No Hit
TCCCTGAGACCCTTAACCTGTGA1656260.8075671203073929No Hit
TCACAGTGAACCGGTCTCTTTT1608030.7840509077487212No Hit
TAACAGTCTACAGTCATGGCT1534850.748369455643318No Hit
TTCACAGTGGCTAAGTTCTGC1443520.7038383403005132No Hit
AACATTCATTGCTGTCGGTGGG1432220.6983286326100094No Hit
AACATTCATTGCTGTCGGTGGGT1331170.6490581934838686No Hit
TCCAGCATCAGTGATTTTGTTG1179010.5748672977151047No Hit
TTCACAGTGGCTAAGTTCTG1177210.5739896451626352No Hit
TGAGGTAGTAGTTTGTGCTGTT1169810.5703815180024824No Hit
TATTGCACTCGTCCCGGCCTCC1163780.5674413819517091No Hit
TCCAGCATCAGTGATTTTGTT1115650.5439739278681746No Hit
AAGCTGCCAGCTGAAGAACT1115550.5439251693930374No Hit
ACCTTGGCTTTAGACTGCTTACT1112630.5425014219190313No Hit
TCTTTGGTTATCTAGCTGTATG1108530.540502324438406No Hit
AGCTACATCTGGCTACTGGGTCT1059950.5168154572167541No Hit
TGAGGTAGTAGTTTGTATAGTT1028070.5012712553430146No Hit
AACCCGTAGATCCGAACTTGTG926680.4518350374014073No Hit
TAAAGCTAGAGAACCGAAAGT902210.4399038385353344No Hit
TTCCCTTTGTCATCCTATGCCTG893700.4357544923011587No Hit
CTGTCTGAGGGTCGCT840670.4098978729359014No Hit
TCCCTGAGACCCTAACTTGTGA831580.4054657275459299No Hit
AGCTGGTGTTGTGAATCAGGCCG802290.3911843701782439No Hit
TCCCTGAGACCCTTAACCTGT792940.3866254527529157No Hit
TACCCTGTAGAACCGAATGTGT769830.3753573691487087No Hit
CCCTGAGACCCTTAACCTGTGA769210.3750550666028581No Hit
TAAAGGGAATTTGCGACTGTT742630.36209506391139024No Hit
TGAGGTAGTAGGTTGTATAGT737360.3595254922716598No Hit
CTACGCCTGTCTGAGGGTCGCT712740.3475211556928811No Hit
TCTTTGGTTATCTAGCTGTATGT644490.31424349641174193No Hit
TGAGGTAGTTGGTTGTATAGTT614630.2996842157357739No Hit
AGCTACATTGTCTGCTGGGTTT611790.2982994750418774No Hit
TATTGCACTTGTCCCGGCCTGT609370.29711951994355723No Hit
TTCAAGTAATCCAGGATAGGC583750.2846275986134065No Hit
AACATTCAACGCTGTCGGTGG560950.27351066628212484No Hit
AAGCTGCCAGTTGAAGAGCTGT552740.2695075954733607No Hit
TTCAAGTAATCCAGGATAGGTT544050.265270483983938No Hit
TGTCTGAGGGTCGCT526550.25673775083492795No Hit
TAGCAGCACGTAAATATTGGAG525810.25637693811891266No Hit
TTCAAGTAATCCAGGATAGGCTT518660.25289070714660283No Hit
TTGCATAGTCACAAAAATGAGC503860.24567445282629718No Hit
TGCTCAGTAGTCAGTGTAGATCC497530.24258804135011244No Hit
AACTCCAGTCACACTGATATCT483070.23553756584527327TruSeq Adapter, Index 25 (100% over 22bp)
AGCTACATTGTCTGCTGGGTTTC472390.2303301607006203No Hit
ACCGTGGCTTTAGATTGTTACT466680.22754605177028614No Hit
TGTAAACATCCTTGACTGGAAGCT458430.22352347757146712No Hit
ATCTACATCTGGCTACTGGGTCTC452970.220861264828976No Hit
TGCTCAGTAGTCAGTGTAGATC435430.21230902828991105No Hit
CCACGTTCCCGTGG427580.20848148799164085No Hit
TAGCTTATCAGACTGGTGTTGG419010.20430288667238278No Hit
TGATGTAGTAGGTTGTATAGTT418440.20402496336410073No Hit
AGAATAATGCCAGCAGTCGGTC413310.20152365358956237No Hit
ACCATCGACCGTTGACTGTGCC411830.2008020281575318No Hit
CCTTTCTGAGGGTCGCT406280.1980959327874172No Hit
TGAGATGAAGCACTGTAGCTCT394100.1921571505157062No Hit
TTATGTAGTAGGTTGTATAGTT384320.18738857164728803No Hit
AACATTCAACGCTGTCGGTGAGA377670.18414613305066418No Hit
AACTCCAGTCACACTGATATCTCG365130.1780318202684593TruSeq Adapter, Index 25 (100% over 24bp)
CCTTGGCTTTAGACTGCTTACT354450.1728244151238063No Hit
TGAGGTAGTAGGTTGTATAGTTT350820.17105448247632593No Hit
CTTTGGTTATCTAGCTGTATGA340550.16604698707973548No Hit
TAACAGTCTACAGCCATGGTCG337180.1644038264676118No Hit
TGTAAACATCCTACACTCTCAGCT333240.16248274254720613No Hit
TGAGATGAAGCACTGTAGCTC330730.1612589048212624No Hit
AACATTCATTGCTGTCGGTGGGTT323220.15759714333845867No Hit
GTACAGTACTGTGATAACTGA321400.15670973909096161No Hit
ACCATCGACCGTTGACTGTACC320740.15638793315505609No Hit
AACATTCAACGCTGTCGGTGAGTT309940.15112201784023846No Hit
AACATTCAACGCTGTCGGTG308390.15036626147561186No Hit
CATTATTACTTTTGGTACGCG305620.14901565171431141No Hit
TTCCCTTTGTCATCCTATGCCT303930.14819163348449274No Hit
TAAATCTAGAGAACCGAAAGTA301280.14689953389335692No Hit
AGCAGCATTGTACAGGGCTATGA299530.14604626057845593No Hit
AAGCTGCCAGCTGAAGAACTGC293860.14328165503817666No Hit
TCCCTGAGACCCTTAACCTGTGG284090.1385179520172722No Hit
TACCCTGTAGAACCGAATTTGT281170.13709420454326596No Hit
AATATTCAACGCTGTCGGTGAG277300.1352072515554563No Hit
TGAGGTAGTAGGTTGTGTGGTT276820.13497321087479774No Hit
AACAGTCAACGCTGTCGGTGAG274530.13385664179415585No Hit
TCACAGTGAACCGGTCTCT270340.1318136616859072No Hit
TGAGGTAGTTGGTTGTATTGTT268570.13095063667597873No Hit
TTAGGTAGTAGGTTGTATAGTT266760.1300681082759954No Hit
TACAGTACTGTGATAACTGAAG264430.12893203580529863No Hit
TAAAGCTAGAGAACCGAAAGTAA257200.12540679805287905No Hit
TTACAATTAAAGGATATTTCTT252830.1232760526893834No Hit
AGCTACATCTGGCTACTGGGTCTCT252240.12298837768607392No Hit
AACTCCAGTCACACTGATATCTC247570.12071135689716668TruSeq Adapter, Index 25 (100% over 23bp)
AAGCCCTTACCCCAAAAAGCAT241700.11784923440661302No Hit
TCCCTGAGACCCTAACTTGTG239740.11689356829392389No Hit
TTCACAGTGGCTAAGTTCTGCT235690.11491885005086727No Hit
AATATTCAACGCTGTCGGTGAGT234330.11425573478900136No Hit
AACAGTCAACGCTGTCGGTGAGT234000.11409483182104858No Hit
AACCCGTAGATCCGAACTTGT233990.11408995597353487No Hit
AACATTCATTGCTGTCGCTGGGT232810.11351460596691593No Hit
TTCACAGTGGTTAAGTTCTG225150.10977970677140637No Hit
CAGGCTGGTTAGATGGTTGTCT224500.10946277668301457No Hit
TGAGGTAGTAGATTGAATAGTT223350.10890205421893676No Hit
AGCTACATTGTCTGCTGGGTT222390.10843397285761965No Hit
CACCACGTTCCCGTGG216990.10580101520021082No Hit
TAAGGCACGCGGTGAATGCC212710.10371415246433865No Hit
ATCTACATCTGGCTACTGGGTCT210900.10283162406435534No Hit
TTTAAGTAATCCAGGATAGGCT210470.10262196262126537No Hit
AAGGTCCAACCTCACATGTCCT209710.10225139821022264No Hit
TAGCAGCACGGAATGGTTTGT206800.10083252658373013No Hit
TGAGATGAAGCACTGTAGCT205210.10005726682904864No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCGAGT56.6473E-43509.240723
CGTATGC19350.03400.42723
CAACCCG800.03289.913323
TAACTAA1650.02977.537623
TAACTGC2650.02648.483423
AATAACC3300.02445.834523
GGCTCGT1100.02392.66423
GTATGCC500.02105.544423
ACTAGCC50.0023008961886.280922
ACAACCC4450.01843.892522
TCGTATG20150.01816.071922
GAAGCCG100.00265841541754.620423
CGTATTT100.00265841541754.620423
CAAGCCT100.00265841541754.620423
GGCGCCC100.00265841541754.620423
ATAACTA21400.01749.657722
TCTGACT34750.01479.435323
ATAAAAA1850.01478.436422
TAATAAC5000.01339.259522
TCGCCTT50.00497016361283.375421