FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_14_JG72_1_GTTTCG_L007_R1_001_TRIMMED_prinseq_good_USD9.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_14_JG72_1_GTTTCG_L007_R1_001_TRIMMED_prinseq_good_USD9.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16252111
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG12480447.6792731725743195No Hit
AACATTCAACGCTGTCGGTGAGT10406486.403155873104731No Hit
TTCAAGTAATCCAGGATAGGCT10265236.3162440866912615No Hit
TCACAGTGAACCGGTCTCTTT6522104.013078670210904No Hit
TGAGGTAGTAGGTTGTATAGTT3668182.2570483305214935No Hit
AACATTCAACGCTGTCGGTGA3450872.1233364699515036No Hit
TTGCATAGTCACAAAAGTGATC1700511.0463317657626139No Hit
CCTGTCTGAGGGTCGCT1636601.0070076434993585No Hit
TCCCTGAGACCCTTAACCTGTG1572040.9672835731924302No Hit
TCTTTGGTTATCTAGCTGTAT1532840.9431636296355593No Hit
TAAAGCTAGAGAACCGAAAGTA1503330.9250059884528231No Hit
TTAAAGGGAATTTGCGACTGTT1472090.9057838701692352No Hit
AGCTACATCTGGCTACTGGGTCTC1427350.8782551386709087No Hit
TCTTTGGTTATCTAGCTGTATGA1358640.8359775539313016No Hit
TCACAGTGAACCGGTCTCTTTT1303520.8020619598278649No Hit
TCACAGTGAACCGGTCTCTT1292820.7954781997243312No Hit
TAGCTTATCAGACTGGTGTTGGC1267270.779757165084585No Hit
AAGCTGCCAGCTGAAGAACTGT1235760.7603689145367023No Hit
TCCCTGAGACCCTTAACCTGTGA1220990.7512808643750957No Hit
AACATTCATTGCTGTCGGTGGG1193420.7343169142765514No Hit
TAACAGTCTACAGTCATGGCT1134480.698050856285685No Hit
TTCACAGTGGCTAAGTTCTGC1132750.6969863791848333No Hit
AACATTCATTGCTGTCGGTGGGT1058820.651496904002194No Hit
TTCACAGTGGCTAAGTTCTG971070.5975039181063925No Hit
TGAGGTAGTAGTTTGTGCTGTT945440.5817336590920404No Hit
TGAGGTAGTAGTTTGTATAGTT898700.5529743182285674No Hit
ACCTTGGCTTTAGACTGCTTACT885610.5449199799336837No Hit
TCCAGCATCAGTGATTTTGTTG872890.5370933043713522No Hit
TCCAGCATCAGTGATTTTGTT864790.5321093364425089No Hit
TATTGCACTCGTCCCGGCCTCC828730.5099214495889179No Hit
TCTTTGGTTATCTAGCTGTATG803150.4941819558086947No Hit
TACCCTGTAGAACCGAATGTGT796630.49017016927831714No Hit
AAGCTGCCAGCTGAAGAACT787110.4843124687002199No Hit
TAAAGCTAGAGAACCGAAAGT757520.4661056031428779No Hit
AGCTACATCTGGCTACTGGGTCT756040.4651949522126695No Hit
TTCCCTTTGTCATCCTATGCCTG725390.4463358636917998No Hit
TACCCTGTAGAACCGAATTTGT687450.4229912040349712No Hit
CCCTGAGACCCTTAACCTGTGA638450.3928412745888826No Hit
TCCCTGAGACCCTTAACCTGT638020.39257669357537617No Hit
TCCCTGAGACCCTAACTTGTGA633960.3900785565641288No Hit
CTGTCTGAGGGTCGCT626610.3855560671472155No Hit
TAAAGGGAATTTGCGACTGTT615420.37867080774922096No Hit
AACCCGTAGATCCGAACTTGTG612030.3765849248752977No Hit
TGAGGTAGTAGGTTGTATAGT596810.36721998760653307No Hit
AGCTGGTGTTGTGAATCAGGCCG560640.34496441723785914No Hit
TACCCTGTAGATCCGGATTTGT551560.3393774507200941No Hit
CTACGCCTGTCTGAGGGTCGCT529130.32557616668997647No Hit
TCTTTGGTTATCTAGCTGTATGT515930.3174541448800097No Hit
TTCAAGTAATCCAGGATAGGC480850.2958692566153406No Hit
TATTGCACTTGTCCCGGCCTGT478210.2942448522533473No Hit
TGAGGTAGTTGGTTGTATAGTT475590.2926327539850054No Hit
AACATTCAACGCTGTCGGTGG445540.27414284827367963No Hit
TTCAAGTAATCCAGGATAGGCTT441840.27186622094815865No Hit
AGCTACATTGTCTGCTGGGTTT429020.2639780149175698No Hit
TGTCTGAGGGTCGCT420150.2585202623831452No Hit
AAGCTGCCAGTTGAAGAGCTGT420060.2584648849617136No Hit
ACCGTGGCTTTAGATTGTTACT415980.2559544418568148No Hit
TTCAAGTAATCCAGGATAGGTT412500.25381318156145993No Hit
TGTAAACATCCTTGACTGGAAGCT388730.2391873892566941No Hit
TTGCATAGTCACAAAAATGAGC377260.23212984454757907No Hit
TAGCAGCACGTAAATATTGGAG374850.23064696026257758No Hit
AACTCCAGTCACGTTTCGATCT369690.2274719881004997TruSeq Adapter, Index 21 (95% over 22bp)
AGAATAATGCCAGCAGTCGGTC354940.21839624403254443No Hit
TACCCTGTAGAACCGAATTTGCG342430.21069878245355325No Hit
TGCTCAGTAGTCAGTGTAGATCC339290.20876672575027333No Hit
CCACGTTCCCGTGG336310.20693311779620507No Hit
AGCTACATTGTCTGCTGGGTTTC325870.20050933691014047No Hit
AACATTCAACGCTGTCGGTGAGA303960.18702801131496086No Hit
ACCATCGACCGTTGACTGTGCC298790.18384688610605723No Hit
TGAGATGAAGCACTGTAGCTCT296360.18235169572740426No Hit
TGCTCAGTAGTCAGTGTAGATC292560.18001353793362596No Hit
TAACGGAACCCATAATGCAGCTG289840.17833990919702677No Hit
GTACAGTACTGTGATAACTGA281520.17322057423801746No Hit
TGAGGTAGTAGGTTGTATAGTTT280000.17228531112050613No Hit
CCTTGGCTTTAGACTGCTTACT279160.1717684551871446No Hit
AACTCCAGTCACGTTTCGATCTCG278980.17165770034428143TruSeq Adapter, Index 21 (95% over 24bp)
ACCATCGACCGTTGACTGTACC276220.1699594594203793No Hit
TTCCCTTTGTCATCCTATGCCT273240.16812585146631104No Hit
TGATGTAGTAGGTTGTATAGTT271770.1672213535829284No Hit
TAGCTTATCAGACTGGTGTTGG271650.16714751702101963No Hit
CCTTTCTGAGGGTCGCT270770.16660604890035516No Hit
TACCCTGTAGAACCGAATTTGC264300.16262502760410633No Hit
TGTAAACATCCTACACTCTCAGCT262940.16178821323580672No Hit
AACATTCAACGCTGTCGGTG261010.16060067519844037No Hit
CTTTGGTTATCTAGCTGTATGA254940.15686577577522084No Hit
TAACAGTCTACAGCCATGGTCG253280.15584437000214926No Hit
TACCCTGTAGATCCGGATTTGTG252930.15562901336324864No Hit
AGCAGCATTGTACAGGGCTATGA251580.15479835204177475No Hit
TGAGATGAAGCACTGTAGCTC246390.15160492073921966No Hit
ATCTACATCTGGCTACTGGGTCTC243300.14970362927006836No Hit
AACATTCATTGCTGTCGGTGGGTT242820.1494082830224332No Hit
TTATGTAGTAGGTTGTATAGTT233470.14365518424037346No Hit
TACAGTACTGTGATAACTGAAG233080.1434152154141699No Hit
AACATTCAACGCTGTCGGTGAGTT231060.14217229995537195No Hit
TGAGGTAGTTGGTTGTATTGTT222290.13677607788920468No Hit
CATTATTACTTTTGGTACGCG222180.1367083943741216No Hit
TAAAGCTAGAGAACCGAAAGTAA218110.13420410431604854No Hit
TCACAGTGAACCGGTCTCT214620.13205669097386796No Hit
TCCCTGAGACCCTTAACCTGTGG208380.12821718975461097No Hit
TAAGGCACGCGGTGAATGCC202610.12466688173616339No Hit
TAAATCTAGAGAACCGAAAGTA201110.12374392471230353No Hit
AAGCTGCCAGCTGAAGAACTGC195390.12022438192798462No Hit
TGAGGTAGTAGATTGAATAGTT194860.11989827044622081No Hit
AACAGTCAACGCTGTCGGTGAG194450.11964599552636576No Hit
AATATTCAACGCTGTCGGTGAG194060.1194060267001622No Hit
TTACAATTAAAGGATATTTCTT192990.11874765068980885No Hit
TCCCTGAGACCCTAACTTGTG192230.1182800191310532No Hit
CAGGCTGGTTAGATGGTTGTCT190300.11709248109368685No Hit
TGAGGTAGTAGGTTGTGTGGTT187530.11538808712295898No Hit
TTCACAGTGGCTAAGTTCTGCT185560.1141759368982897No Hit
AAGCCCTTACCCCAAAAAGCAT180480.11105018911081767No Hit
AACTCCAGTCACGTTTCGATCTC180090.11081022028461411TruSeq Adapter, Index 21 (95% over 23bp)
AACTCCAGTCACGTTTCGATCTCGTATGC171370.10544476345257549TruSeq Adapter, Index 21 (96% over 29bp)
TTTAAGTAATCCAGGATAGGCT170190.10471870392713906No Hit
AACATTCAACGCTGTCGGTGT166020.10215288340080866No Hit
AACCCGTAGATCCGAACTTGT165370.10175293535713606No Hit
TGAGATGAAGCACTGTAGCT164650.10130991598568334No Hit
AGCTACATCTGGCTACTGGGTCTCT164290.10108840629995697No Hit
AATATTCAACGCTGTCGGTGAGT162780.10015929622927137No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATTCCG50.00136564152448.294723
CGTATGC20400.02424.29223
CAACCCG2200.02337.008523
TAACTAA1900.02061.721723
AATAACC3350.01900.16923
TAACTGC2050.01731.720723
GATTCCT2950.01452.378223
TCGCAAC50.00464647031327.296922
ATCACTA50.00464647031327.296922
TCGTATG21150.01289.643122
ATAACTA19200.01258.166922
GATCACC100.005461081224.147323
CTCGCAC100.005461081224.147323
ACAACCC5750.01200.33822
ATAAAAA1300.01020.997622
AATGCTC1050.01011.273822
TAATAAC4300.0987.755822
GCTGAGC1750.0979.317923
TAACACC252.3189965E-5979.317823
TCTGACT31500.0928.7975523