FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_14_JG73_1_CGTACG_L008_R1_001_TRIMMED_prinseq_good_O_Oo.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_14_JG73_1_CGTACG_L008_R1_001_TRIMMED_prinseq_good_O_Oo.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15679790
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG13044358.319212183326435No Hit
AACATTCAACGCTGTCGGTGAGT10380646.620394788450611No Hit
TTCAAGTAATCCAGGATAGGCT8983795.729534643002234No Hit
TCACAGTGAACCGGTCTCTTT6129993.9094847571300386No Hit
AACATTCAACGCTGTCGGTGA3410692.175214081311038No Hit
TGAGGTAGTAGGTTGTATAGTT3174352.02448502180195No Hit
TCCCTGAGACCCTTAACCTGTG1513970.9655550233772264No Hit
TTAAAGGGAATTTGCGACTGTT1449330.924329981460211No Hit
TAAAGCTAGAGAACCGAAAGTA1398900.8921675609175889No Hit
TCTTTGGTTATCTAGCTGTAT1386840.8844761313767595No Hit
CCTGTCTGAGGGTCGCT1362290.8688190339283881No Hit
TCTTTGGTTATCTAGCTGTATGA1301480.8300366267660472No Hit
TTGCATAGTCACAAAAGTGATC1281830.8175045711709149No Hit
TCACAGTGAACCGGTCTCTT1227760.7830206909658867No Hit
TCACAGTGAACCGGTCTCTTTT1198580.7644107478480261No Hit
AACATTCATTGCTGTCGGTGGG1178060.7513238378830328No Hit
AGCTACATCTGGCTACTGGGTCTC1147830.7320442429394782No Hit
TCCCTGAGACCCTTAACCTGTGA1147750.7319932218479968No Hit
TAGCTTATCAGACTGGTGTTGGC1147570.7318784243921633No Hit
TTCACAGTGGCTAAGTTCTGC1053670.6719924182658058No Hit
AAGCTGCCAGCTGAAGAACTGT1052050.6709592411633064No Hit
AACATTCATTGCTGTCGGTGGGT1037210.6614948286934965No Hit
TAACAGTCTACAGTCATGGCT1031480.6578404430161373No Hit
TGAGGTAGTAGTTTGTGCTGTT958740.6114495155866245No Hit
TTCACAGTGGCTAAGTTCTG919320.5863088727591378No Hit
TGAGGTAGTAGTTTGTATAGTT792900.5056827929455687No Hit
TCCAGCATCAGTGATTTTGTT788350.502780968367561No Hit
TCTTTGGTTATCTAGCTGTATG768700.4902489127724287No Hit
TATTGCACTCGTCCCGGCCTCC766310.48872465766442025No Hit
ACCTTGGCTTTAGACTGCTTACT765400.48814429274881865No Hit
TCCAGCATCAGTGATTTTGTTG748200.4771747580803059No Hit
TTCCCTTTGTCATCCTATGCCTG696200.4440110486173603No Hit
TCCCTGAGACCCTAACTTGTGA655920.4183219290564478No Hit
TAAAGCTAGAGAACCGAAAGT654560.41745457050126306No Hit
AAGCTGCCAGCTGAAGAACT645940.41195704789413634No Hit
AACCCGTAGATCCGAACTTGTG607720.3875817214388713No Hit
TCCCTGAGACCCTTAACCTGT607430.38739676998225103No Hit
AGCTACATCTGGCTACTGGGTCT573430.36571280610263274No Hit
CCCTGAGACCCTTAACCTGTGA572450.36508779773198496No Hit
TGAGGTAGTAGGTTGTATAGT564080.35974971603573774No Hit
TAAAGGGAATTTGCGACTGTT553280.3528618686857413No Hit
CTGTCTGAGGGTCGCT545640.34798935444926243No Hit
TACCCTGTAGAACCGAATGTGT494980.3156802482686311No Hit
TGAGGTAGTTGGTTGTATAGTT476830.3041048381387761No Hit
AGCTGGTGTTGTGAATCAGGCCG472010.3010308173770185No Hit
AACATTCAACGCTGTCGGTGG466040.29722336842521485No Hit
TCTTTGGTTATCTAGCTGTATGT458880.29265698073762464No Hit
TATTGCACTTGTCCCGGCCTGT455680.29061613707836653No Hit
TTCAAGTAATCCAGGATAGGC454550.28989546416119094No Hit
CTACGCCTGTCTGAGGGTCGCT434360.2770190161985588No Hit
AACTCCAGTCACCGTACGATCT411590.2624971380356497TruSeq Adapter, Index 22 (95% over 22bp)
TTCAAGTAATCCAGGATAGGCTT407700.26001623746236396No Hit
TTCAAGTAATCCAGGATAGGTT379760.2421971212624659No Hit
AGCTACATTGTCTGCTGGGTTT378340.24129149688867008No Hit
ACCGTGGCTTTAGATTGTTACT363390.23175693041807321No Hit
TAGCAGCACGTAAATATTGGAG356930.22763697728094573No Hit
TGTCTGAGGGTCGCT340670.21726694043734004No Hit
AAGCTGCCAGTTGAAGAGCTGT339660.21662279915738666No Hit
AGAATAATGCCAGCAGTCGGTC337490.2152388520509522No Hit
ACCATCGACCGTTGACTGTGCC329890.210391848360214No Hit
TGTAAACATCCTTGACTGGAAGCT320520.20441600302044863No Hit
AGCTACATTGTCTGCTGGGTTTC303440.19352299998915803No Hit
ACCATCGACCGTTGACTGTACC300030.191348225964761No Hit
TTGCATAGTCACAAAAATGAGC295580.1885101777511051No Hit
AACTCCAGTCACCGTACGATCTCG290860.18549993335369924TruSeq Adapter, Index 22 (95% over 24bp)
TTCCCTTTGTCATCCTATGCCT290130.18503436589393096No Hit
GTACAGTACTGTGATAACTGA287840.18357388715027434No Hit
AACTCCAGTCACCGTACGATCTCGTATGC287210.18317209605485787TruSeq Adapter, Index 22 (96% over 29bp)
TAAATCTAGAGAACCGAAAGTA282940.18044884529703523No Hit
AACATTCAACGCTGTCGGTGAGA279520.17826769363620304No Hit
TGCTCAGTAGTCAGTGTAGATCC277650.17707507562282404No Hit
CCACGTTCCCGTGG269550.17190919011032674No Hit
TGAGATGAAGCACTGTAGCTCT267460.17057626409537374No Hit
TACCCTGTAGAACCGAATTTGT259500.165499665492969No Hit
AACATTCATTGCTGTCGGTGGGTT254500.16231084727537803No Hit
TAGCTTATCAGACTGGTGTTGG252310.16091414489607322No Hit
AACATTCAACGCTGTCGGTG247630.1579294110444081No Hit
TGAGGTAGTTGGTTGTATTGTT240180.15317807190019764No Hit
TGCTCAGTAGTCAGTGTAGATC236340.15072905950908783No Hit
CTTTGGTTATCTAGCTGTATGA235050.14990634440894937No Hit
AACATTCAACGCTGTCGGTGAGTT234220.14937700058482925No Hit
TGTAAACATCCTACACTCTCAGCT231740.14779534674890416No Hit
TGAGGTAGTAGGTTGTATAGTTT229880.14660910637196034No Hit
AACAGTCAACGCTGTCGGTGAG229290.1462328258222846No Hit
ATCTACATCTGGCTACTGGGTCTC228270.14558230690589605No Hit
AGCAGCATTGTACAGGGCTATGA222460.14187690013705542No Hit
TAACAGTCTACAGCCATGGTCG217910.13897507555904767No Hit
TGAGATGAAGCACTGTAGCTC216750.13823526973256656No Hit
TCCCTGAGACCCTTAACCTGTGG211860.13511660551576266No Hit
CCTTGGCTTTAGACTGCTTACT211540.13491252114983684No Hit
TCACAGTGAACCGGTCTCT205430.13101578528794072No Hit
TAAGGCACGCGGTGAATGCC204780.1306012389196539No Hit
TAAAGCTAGAGAACCGAAAGTAA198930.12687032160507253No Hit
TACAGTACTGTGATAACTGAAG195540.12470830285354587No Hit
TCCCTGAGACCCTAACTTGTG189420.12080518935521459No Hit
AATATTCAACGCTGTCGGTGAG189140.12062661553502949No Hit
TGATGTAGTAGGTTGTATAGTT186850.11916613679137285No Hit
CATTATTACTTTTGGTACGCG186240.11877710096882675No Hit
AAGCCCTTACCCCAAAAAGCAT184460.11764188168336437No Hit
AAGGTCCAACCTCACATGTCCT184130.11743141968100339No Hit
AACTCCAGTCACCGTACGATCTC183760.11719544713290166TruSeq Adapter, Index 22 (95% over 23bp)
CCTTTCTGAGGGTCGCT183650.11712529313211466No Hit
TTCACAGTGGCTAAGTTCTGCT179470.11445944110220864No Hit
AACAGTCAACGCTGTCGGTGAGT178900.11409591582540327No Hit
TGAGGTAGTAGATTGAATAGTT178500.11384081036799601No Hit
CAGGCTGGTTAGATGGTTGTCT176240.11239946453364491No Hit
TGAGGTAGTAGGTTGTGTGGTT174110.11104102797295118No Hit
AACATTCAACGCTGTCGGTGT172450.10998234032471098No Hit
AAGCTGCCAGCTGAAGAACTGC167530.10684454319860152No Hit
ACCATCGACCGTTGACTGTGCCT161700.10312638115689049No Hit
ACCATTGACCGTTGACTGTACC161510.10300520606462203No Hit
TGAGTTAGTAGGTTGTATAGTT158140.10085594258596575No Hit
TTACAATTAAAGGATATTTCTT156980.10011613675948466No Hit
TCGTACCGTGAGTAATAATGCA156860.10003960512226248No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC28700.01549.445823
CAACCCG6750.01378.343423
TAACTGC1400.01295.325723
AATAACC3700.01150.724123
TAACTAA1200.01116.983823
TAACACC151.8757264E-51051.278823
GTATGCC550.0860.1371523
TCGTATG30250.0841.384522
ACAACCC13850.0805.945422
ATAACTA15850.0800.158222
GATTCCT3000.0735.895223
TAATAAC4700.0646.878122
ATAAAAA900.0627.369122
TCTGACT27950.0581.1183523
ATTTCCC552.235538E-9573.4247423
GACAACC23550.0547.2776521
GATAACA3850.0533.791221
GATAAAA3850.0488.037721
GGGGGCT352.3783438E-4450.5480323
CTCGTAT51500.0448.0736721