FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_5_JG20_1_ACAGTG_L007_R1_001_TRIMMED_prinseq_good_bVaq.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_5_JG20_1_ACAGTG_L007_R1_001_TRIMMED_prinseq_good_bVaq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11762112
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG10190038.663435614284237No Hit
AACATTCAACGCTGTCGGTGAGT7042515.9874536137727645No Hit
TCACAGTGAACCGGTCTCTTT5901365.017262205971173No Hit
TTCAAGTAATCCAGGATAGGCT4643933.9482110015616243No Hit
CCTGTCTGAGGGTCGCT2480932.1092555486633695No Hit
AACATTCAACGCTGTCGGTGA2309291.9633293748605691No Hit
TGAGGTAGTAGGTTGTATAGTT2252921.9154043083419032No Hit
TAGCTTATCAGACTGGTGTTGGC1578681.3421739225064342No Hit
TCCCTGAGACCCTTAACCTGTG1456501.238298019947438No Hit
TCCCTGAGACCCTTAACCTGTGA1323031.1248235010855194No Hit
TAAAGCTAGAGAACCGAAAGTA1265811.076175775234924No Hit
AGCTACATCTGGCTACTGGGTCTC1141880.9708120446396021No Hit
TCTTTGGTTATCTAGCTGTATGA1124500.956035786770267No Hit
TTGCATAGTCACAAAAGTGATC1028870.8747323609909513No Hit
AAGCTGCCAGCTGAAGAACTGT988610.8405038142809726No Hit
TTAAAGGGAATTTGCGACTGTT980420.8335407790709695No Hit
TCTTTGGTTATCTAGCTGTAT956890.8135358683882623No Hit
TCACAGTGAACCGGTCTCTTTT951220.8087153055505678No Hit
TATTGCACTCGTCCCGGCCTCC883790.7513871658423249No Hit
TCACAGTGAACCGGTCTCTT852590.7248613174232654No Hit
AACATTCATTGCTGTCGGTGGG840160.7142934874281082No Hit
CTGTCTGAGGGTCGCT804290.683797263620683No Hit
TGAGGTAGTAGTTTGTGCTGTT759910.6460659446194698No Hit
AACCCGTAGATCCGAACTTGTG757920.6443740715953054No Hit
TCTTTGGTTATCTAGCTGTATG707530.6015331260236256No Hit
CTACGCCTGTCTGAGGGTCGCT687770.5847334220248881No Hit
ACCTTGGCTTTAGACTGCTTACT678370.5767416600011971No Hit
AACATTCATTGCTGTCGGTGGGT673960.5729923333496569No Hit
TTCACAGTGGCTAAGTTCTGC666300.566479897487798No Hit
AGCTGGTGTTGTGAATCAGGCCG648970.5517461489909294No Hit
TGAGGTAGTAGTTTGTATAGTT641090.5450466718902184No Hit
TCCCTGAGACCCTAACTTGTGA579190.4924200687767639No Hit
TTCCCTTTGTCATCCTATGCCTG576300.48996302704820355No Hit
TGTCTGAGGGTCGCT569580.48424976738871384No Hit
TAACAGTCTACAGTCATGGCT543560.4621278899571778No Hit
AGCTACATCTGGCTACTGGGTCT494150.4201201280858403No Hit
CCCTGAGACCCTTAACCTGTGA488300.41514653150726677No Hit
AAGCTGCCAGCTGAAGAACT476550.40515682897765304No Hit
TATTGCACTTGTCCCGGCCTGT456460.3880765631206368No Hit
TACCCTGTAGAACCGAATGTGT451080.38350255464324773No Hit
TCCAGCATCAGTGATTTTGTTG445970.37915809677717743No Hit
TAAAGGGAATTTGCGACTGTT445930.37912408927920427No Hit
CCTTTCTGAGGGTCGCT444840.37819738495943583No Hit
TGAGGTAGTTGGTTGTATAGTT439000.3732322902553555No Hit
TTCACAGTGGCTAAGTTCTG436350.3709792935146341No Hit
TAAAGCTAGAGAACCGAAAGT432980.36811416181039597No Hit
CCACGTTCCCGTGG374230.3181656491623273No Hit
TACCCTGTAGAACCGAATTTGT350150.2976931353824891No Hit
TGTAAACATCCTTGACTGGAAGCT341790.2905855683061001No Hit
TCTTTGGTTATCTAGCTGTATGT335610.28533140986924793No Hit
TCCCTGAGACCCTTAACCTGT330330.2808424201367917No Hit
ACCATCGACCGTTGACTGTACC307090.2610840638143898No Hit
TAGCAGCACGTAAATATTGGAG298620.25388297611857463No Hit
TAGCTTATCAGACTGGTGTTGG296570.2521400918474505No Hit
AACATTCAACGCTGTCGGTGG276310.23491529412404846No Hit
TACCCTGTAGATCCGGATTTGT272520.2316930836910922No Hit
TGAGATGAAGCACTGTAGCTC272360.2315570536991996No Hit
TGTAAACATCCTACACTCTCAGCT270070.2296101244402366No Hit
AAGCTGCCAGTTGAAGAGCTGT269560.22917652884107886No Hit
TGCTCAGTAGTCAGTGTAGATCC265060.22535068531909916No Hit
CTTTGGTTATCTAGCTGTATGA262910.22352278230304218No Hit
AAGGTCCAACCTCACATGTCCT256570.2181325938742974No Hit
ACCATCGACCGTTGACTGTGCC243870.20733521326782128No Hit
TACCCTGTAGAACCGAATTTGCG236900.20140940674599933No Hit
ACCGTGGCTTTAGATTGTTACT234030.19896936876642562No Hit
TGAGGTAGTAGGTTGTATAGT233670.19866330128466722No Hit
TTCAAGTAATCCAGGATAGGTT227900.19375771970203992No Hit
TCCCTGAGACCCTTAACCTGTGG218100.1854258826986174No Hit
AACATTCATTGCTGTCGGTGGGTT216590.18414209965013087No Hit
AGCTACATTGTCTGCTGGGTTT216040.183674496553No Hit
CCTGTCTGAGGGTCGCTT213640.1816340466746108No Hit
AACATTCAACGCTGTCGGTGAGTT211010.179398053682876No Hit
TGCTCAGTAGTCAGTGTAGATC210150.1786668924764532No Hit
CATTATTACTTTTGGTACGCG209240.17789322189756396No Hit
AGCAGCATTGTACAGGGCTATGA206850.1758612738936681No Hit
ATCTACATCTGGCTACTGGGTCTC206490.1755552064119097No Hit
AGAATAATGCCAGCAGTCGGTC203390.17291962531899033No Hit
TCCAGCATCAGTGATTTTGTT202500.17216295848908766No Hit
CACCACGTTCCCGTGG199570.1696719092625542No Hit
TTGCATAGTCACAAAAATGAGC194680.16551449263533624No Hit
TTCAAGTAATCCAGGATAGGC190700.1621307465870075No Hit
AGCTACATTGTCTGCTGGGTTTC189200.16085546541301426No Hit
AGCTACATCTGGCTACTGGGTCTCT186990.15897655114999756No Hit
TGAGGTAGTTGGTTGTATTGTT176900.1503981597862697No Hit
TAAATCTAGAGAACCGAAAGTA176460.15002407730856498No Hit
AAGCTGCCAGCTGAAGAACTGC176280.1498710435676858No Hit
TGATGTAGTAGGTTGTATAGTT172890.14698890811446108No Hit
TCTTTGGTTATCTAGCTGTA167950.14278898211477667No Hit
TACCCTGTAGAACCGAATTTGC167320.1422533640216995No Hit
AACAGTCAACGCTGTCGGTGAG165820.14097808284770627No Hit
AACATTCATTGCTGTCGCTGGGTT165530.1407315284874009No Hit
TGTAAACATCCCCGACTGGAAGCT163760.13922669670208887No Hit
AATATTCAACGCTGTCGGTGAG163020.13859755798958556No Hit
TTCCCTTTGTCATCCTATGCCT157160.13361545953651863No Hit
TACGCCTGTCTGAGGGTCGCT156850.13335190142722667No Hit
AAGCCCTTACCCCAAAAAGCAT156810.13331789392925353No Hit
TTATGTAGTAGGTTGTATAGTT153590.1305802903424147No Hit
GAAGGATCATTA151740.12900744356115637No Hit
TGAGATGAAGCACTGTAGCTCT151370.1286928742049047No Hit
CCTTGGCTTTAGACTGCTTACT150900.12829328610372015No Hit
TACCCTGTAGATCCGGATTTGTG148810.1265163943346229No Hit
TACCCTGTAGAACCGAATGTGTG148310.1260913006099585No Hit
AACATTCAACGCTGTCGGTGAGA144910.12320066328224047No Hit
CAGGCTGGTTAGATGGTTGTCT144380.1227500639340962No Hit
TATGGCTTTTTATTCCTATCTG144230.12262253581669685No Hit
ACCACGTTCCCGTGG144220.12261403394220358No Hit
TCCCTGAGACCCTAACTTGTG141390.120208003460603No Hit
CTTTTTGCGGTCTGGGCTTGC140800.11970639286549899No Hit
TGAGGTAGTAGATTGAATAGTT138890.11808253483728093No Hit
TCACAGTGAACCGGTCTCT134640.1144692381776334No Hit
TGAGGTAGTAGGTTGTGTGGTT133960.1138911107120898No Hit
TAACAGTCTACAGCCATGGTCG133820.11377208446918376No Hit
AACATTCATTGCTGTCGCTGGGT129580.11016728968402953No Hit
TTCAAGTAATCCAGGATAGGCTT126220.10731065985428467No Hit
CAAGCTCGTATCTATAGGTATG126040.10715762611340549No Hit
TCGTACCGTGAGTAATAATGCA121120.10297470386270766No Hit
TGAGGTAGTTGTTTGTACAGTT119840.10188646392756676No Hit
AACATTCAACGCTGTCGGTG119010.10118080834462383No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTACTAT54.6757728E-44182.97423
TAACTGC1250.03179.0623
CAACCCG1650.03168.919423
TAACTAA400.03137.230523
AATAACC1750.02509.784423
ACTGACG50.00179899262132.97522
TAGCCAT50.00179899262132.97522
CCAAATT50.00179899262132.97522
AGCCATC100.00187001182091.48723
TAACAAA202.3778848E-62091.48723
ACAACCC5400.01994.726622
ATAACTA5050.01879.552122
AACTGCA355.30963E-91792.70323
GGAAAGT254.643476E-61673.189523
GGGCCCT254.643476E-61673.189523
TCTGACT18350.01538.69623
AATGCTC350.01523.553522
GATTCCT3050.01440.0423
TAAAACC150.00420685761394.324623
GGGCAGC150.00420685761394.324623