FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_5_JG21_1_TGACCA_L002_R1_001_TRIMMED_prinseq_good_MaKT.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_5_JG21_1_TGACCA_L002_R1_001_TRIMMED_prinseq_good_MaKT.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14031891
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG154596911.017538548439408No Hit
AACATTCAACGCTGTCGGTGAGT12398348.835829753808664No Hit
TTCAAGTAATCCAGGATAGGCT5875014.18689825911561No Hit
TCACAGTGAACCGGTCTCTTT5737174.088664884868333No Hit
AACATTCAACGCTGTCGGTGA3277832.3359859337561844No Hit
CCTGTCTGAGGGTCGCT2242581.5982022665369906No Hit
TGAGGTAGTAGGTTGTATAGTT2146791.5299363428635528No Hit
TCCCTGAGACCCTTAACCTGTGA1759691.2540647586273297No Hit
TCCCTGAGACCCTTAACCTGTG1685491.2011852144518511No Hit
TAGCTTATCAGACTGGTGTTGGC1513501.0786144219620863No Hit
TAAAGCTAGAGAACCGAAAGTA1317570.938982493521365No Hit
TTAAAGGGAATTTGCGACTGTT1315960.9378351071854819No Hit
AACATTCATTGCTGTCGGTGGG1156480.8241797203242243No Hit
AGCTACATCTGGCTACTGGGTCTC1075810.7666892509356009No Hit
AACATTCATTGCTGTCGGTGGGT1073250.7648648353953149No Hit
TCTTTGGTTATCTAGCTGTATGA1048370.7471337968631597No Hit
AAGCTGCCAGCTGAAGAACTGT1008930.7190263949456278No Hit
CTGTCTGAGGGTCGCT947250.6750693830218607No Hit
TCTTTGGTTATCTAGCTGTAT884270.6301859100815421No Hit
TCACAGTGAACCGGTCTCTTTT880530.6275205530031555No Hit
TCACAGTGAACCGGTCTCTT822970.5864997098395363No Hit
CTACGCCTGTCTGAGGGTCGCT810490.5776056840806417No Hit
TATTGCACTCGTCCCGGCCTCC808140.5759309276276448No Hit
TTCCCTTTGTCATCCTATGCCTG807420.5754178107569393No Hit
TTCACAGTGGCTAAGTTCTGC797390.5682698076830842No Hit
TGAGGTAGTAGTTTGTGCTGTT785000.5594399215330279No Hit
AGCTGGTGTTGTGAATCAGGCCG721720.5143426498965821No Hit
TCTTTGGTTATCTAGCTGTATG701070.4996261729798215No Hit
TTGCATAGTCACAAAAGTGATC654530.46645886858727736No Hit
TCCCTGAGACCCTAACTTGTGA652990.465361368613824No Hit
TGAGGTAGTAGTTTGTATAGTT633890.451749518293721No Hit
ACCTTGGCTTTAGACTGCTTACT605740.43168807397377873No Hit
TGTCTGAGGGTCGCT595410.4243262722037964No Hit
AACCCGTAGATCCGAACTTGTG588890.4196797138746303No Hit
TAACAGTCTACAGTCATGGCT547810.3904035457516026No Hit
CCCTGAGACCCTTAACCTGTGA537440.3830132374888032No Hit
TTCACAGTGGCTAAGTTCTG515300.36723489371461054No Hit
TCCAGCATCAGTGATTTTGTTG500390.3566090985170851No Hit
TGAGGTAGTTGGTTGTATAGTT491030.3499385791979142No Hit
TAAAGCTAGAGAACCGAAAGT490820.3497889201106252No Hit
TAAAGGGAATTTGCGACTGTT486700.3468527513504773No Hit
CCTTTCTGAGGGTCGCT468350.3337753977706925No Hit
CCACGTTCCCGTGG447250.318738222809741No Hit
TATTGCACTTGTCCCGGCCTGT429890.3063664049271762No Hit
TCCCTGAGACCCTTAACCTGT410820.292775934476686No Hit
AACAGTCAACGCTGTCGGTGAG398850.28424536650120785No Hit
ACCATCGACCGTTGACTGTACC395360.28175817500292727No Hit
AAGCTGCCAGCTGAAGAACT391460.27897879195327274No Hit
AGCTACATCTGGCTACTGGGTCT363360.25895298074935164No Hit
AACATTCAACGCTGTCGGTGG357530.25479815942127826No Hit
TGTAAACATCCTACACTCTCAGCT336520.23982512406916504No Hit
AACATTCAACGCTGTCGGTGAGTT329680.2349505137974632No Hit
AACATTCATTGCTGTCGGTGGGTT328100.23382450733119292No Hit
TAGCAGCACGTAAATATTGGAG325330.2318504327036178No Hit
AACAGTCAACGCTGTCGGTGAGT314390.2240539069181766No Hit
AGAATAATGCCAGCAGTCGGTC313490.2234125108297948No Hit
TAGCTTATCAGACTGGTGTTGG308700.21999885831496266No Hit
TCTTTGGTTATCTAGCTGTATGT307810.2193645888497851No Hit
TGTAAACATCCTTGACTGGAAGCT301540.21489619610072513No Hit
TAAATCTAGAGAACCGAAAGTA300930.21446147208526636No Hit
TCCAGCATCAGTGATTTTGTT299670.21356351756153183No Hit
TACCCTGTAGAACCGAATGTGT299240.2132570727637494No Hit
TGATGTAGTAGGTTGTATAGTT295720.21074850139585605No Hit
AATATTCAACGCTGTCGGTGAG286360.20407798207668515No Hit
AAGCTGCCAGTTGAAGAGCTGT275330.19621731668240583No Hit
TGAGGTAGTAGGTTGTATAGT274580.19568281994208764No Hit
TGAGATGAAGCACTGTAGCTC274540.19565431344927067No Hit
AAGGTCCAACCTCACATGTCCT258530.1842445896992786No Hit
TTCAAGTAATCCAGGATAGGTT251130.17897088852813922No Hit
TCCCTGAGACCCTTAACCTGTGG248650.1772034859734871No Hit
GCATCGATGGTTCAGTGGTAGAATGCTC247820.17661197624753497No Hit
TGAGGTAGTTGGTTGTATTGTT239470.17066124587199258No Hit
TTCAAGTAATCCAGGATAGGC234920.1674186323140623No Hit
ACCATCGACCGTTGACTGTGCC231290.1648316680909223No Hit
CACCACGTTCCCGTGG230830.16450384342352717No Hit
AATATTCAACGCTGTCGGTGAGT229280.1633992168268696No Hit
AACATTCAACGCTGTCGGTGAGA224550.16002832405126294No Hit
AGCTACATTGTCTGCTGGGTTT214600.15293733396304177No Hit
AGCAGCATTGTACAGGGCTATGA206250.14698660358749935No Hit
ATCTACATCTGGCTACTGGGTCTC202890.14459205819087392No Hit
ACCACGTTCCCGTGG202670.14443527248038057No Hit
AGCTACATTGTCTGCTGGGTTTC199490.1421690063014315No Hit
TTGCATAGTCACAAAAATGAGC197620.14083632776223817No Hit
TACCCTGTAGAACCGAATTTGT195030.13899053235233938No Hit
TTCCCTTTGTCATCCTATGCCT192470.13716611681205335No Hit
AAGCCCTTACCCCAAAAAGCAT192230.13699507785515153No Hit
TGCTCAGTAGTCAGTGTAGATCC190600.13583343827286No Hit
ACCATTGACCGTTGACTGTACC190210.13555549996789457No Hit
TAACAGTCTACAGCCATGGTCG189970.13538446101099275No Hit
CTTTGGTTATCTAGCTGTATGA189570.13509939608282306No Hit
ACCGTGGCTTTAGATTGTTACT186100.13262645783095095No Hit
CTACTCCTGTCTGAGGGTCGCT185230.13200644161218186No Hit
CATTATTACTTTTGGTACGCG183960.13110136046524307No Hit
TTCAAGTAATCCAGGATAGGCTT183730.13093744813154548No Hit
AACATTCAACGCTGTCGGTG179700.1280654189802358No Hit
GAAGGATCATTA176600.12585616578692066No Hit
TGTAAACATCCCCGACTGGAAGCT164800.11744675040591464No Hit
CTTTTTGCGGTCTGGGCTTGC163590.1165844289982013No Hit
TCCCTGAGACCCTAACTTGTG162760.1159929192722492No Hit
AGCTACATCTGGCTACTGGGTCTCT160270.11421839009439283No Hit
TGAGATGAAGCACTGTAGCTCT157410.11218017585797951No Hit
TACGCCTGTCTGAGGGTCGCT157280.11208752975632437No Hit
AAGCTGCCAGCTGAAGAACTGC155220.11061944537625043No Hit
AACATTCATTGCTGTCGCTGGGTT150380.1071701597453971No Hit
CAGGCTGGTTAGATGGTTGTCT147840.10535999745151954No Hit
TAATCTCTGCAGGCAACTGTGA143210.10206037090795532No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACCCG1350.02836.499523
TAACTGC1100.02531.751723
AATAACC1750.02387.0823
TATCCCC5300.02331.719223
GATTCCT4250.02252.514423
TAACTAA1050.01823.463923
CGACAAT100.00270079751740.579323
TCGGATA204.129248E-61740.579323
GGAAGAT100.00270079751740.579323
GGCTCGT1300.01606.688623
CACGTGT502.7284841E-111392.463423
ATCACTA50.00440825431362.661922
CTCATGC50.00440825431362.661922
TTTAACT900.01353.783823
AATGCTC31250.01314.696322
ACAACCC6050.01306.353522
ATAACTA9800.01237.519422
TCTGACT23800.01235.957523
GATACCA150.00607563231160.386223
TCGTGCT150.00607563231160.386223