FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_5_JG23_1_ATCACG_L007_R1_001_TRIMMED_prinseq_good_VSNX.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_5_JG23_1_ATCACG_L007_R1_001_TRIMMED_prinseq_good_VSNX.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10111076
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG9573489.468309802042828No Hit
AACATTCAACGCTGTCGGTGAGT7663047.578857087020214No Hit
TCACAGTGAACCGGTCTCTTT4676474.625096280554117No Hit
TTCAAGTAATCCAGGATAGGCT4219934.1735716356993064No Hit
TGAGGTAGTAGGTTGTATAGTT2349222.3234124637180056No Hit
CCTGTCTGAGGGTCGCT1864171.8436910176523251No Hit
AACATTCAACGCTGTCGGTGA1769791.7503478363727065No Hit
TCCCTGAGACCCTTAACCTGTG1303181.288863816274351No Hit
AGCTACATCTGGCTACTGGGTCTC1286041.2719121090574337No Hit
TAGCTTATCAGACTGGTGTTGGC1257041.243230690779102No Hit
TAAAGCTAGAGAACCGAAAGTA1240991.2273570092836805No Hit
TCCCTGAGACCCTTAACCTGTGA1168931.1560886299341435No Hit
TCTTTGGTTATCTAGCTGTATGA914920.9048690762486603No Hit
TTAAAGGGAATTTGCGACTGTT853400.8440249089216617No Hit
AAGCTGCCAGCTGAAGAACTGT803890.795058804819586No Hit
TCACAGTGAACCGGTCTCTTTT748630.7404058677830134No Hit
AACATTCATTGCTGTCGGTGGG744870.7366871735510642No Hit
TATTGCACTCGTCCCGGCCTCC730270.7222475629695593No Hit
TCTTTGGTTATCTAGCTGTAT714450.7066013547915178No Hit
CTGTCTGAGGGTCGCT694770.6871375509391878No Hit
AACATTCATTGCTGTCGGTGGGT677160.6697210069432769No Hit
TCACAGTGAACCGGTCTCTT670490.6631242807392606No Hit
TGAGGTAGTAGTTTGTGCTGTT660610.65335281823616No Hit
TTGCATAGTCACAAAAGTGATC655770.6485659884269488No Hit
AACCCGTAGATCCGAACTTGTG652860.6456879564548818No Hit
CTACGCCTGTCTGAGGGTCGCT606650.5999855999499955No Hit
TCTTTGGTTATCTAGCTGTATG592790.5862778600417997No Hit
AGCTGGTGTTGTGAATCAGGCCG540960.5350172424774574No Hit
TTCACAGTGGCTAAGTTCTGC539700.533771084303985No Hit
TGAGGTAGTAGTTTGTATAGTT534760.5288853530524348No Hit
TCCCTGAGACCCTAACTTGTGA526270.5204886205978474No Hit
TGTCTGAGGGTCGCT488430.48306431481674156No Hit
TTCCCTTTGTCATCCTATGCCTG474680.4694653664951188No Hit
AGCTACATCTGGCTACTGGGTCT457420.45239497754739455No Hit
TATTGCACTTGTCCCGGCCTGT449230.4442949494198244No Hit
CCCTGAGACCCTTAACCTGTGA446130.441229004707313No Hit
TGAGGTAGTTGGTTGTATAGTT439060.4342366727339405No Hit
TAAAGCTAGAGAACCGAAAGT410460.4059508602249652No Hit
ACCTTGGCTTTAGACTGCTTACT384900.38067165156309773No Hit
AAGCTGCCAGCTGAAGAACT370160.36609357896231814No Hit
TAAAGGGAATTTGCGACTGTT355980.35206935443863735No Hit
TCCAGCATCAGTGATTTTGTTG350530.34667922583115784No Hit
TTCACAGTGGCTAAGTTCTG336900.333198959240342No Hit
TAACAGTCTACAGTCATGGCT334470.3307956541915025No Hit
CCACGTTCCCGTGG309390.30599117245286256No Hit
ACCATCGACCGTTGACTGTACC306150.3027867657210766No Hit
CCTTTCTGAGGGTCGCT302280.2989592799025544No Hit
TCCCTGAGACCCTTAACCTGT298450.29517135466096783No Hit
TGAGGTAGTAGGTTGTATAGT272230.2692393964796625No Hit
TCTTTGGTTATCTAGCTGTATGT271440.2684580750851838No Hit
TAGCAGCACGTAAATATTGGAG268280.2653327895072691No Hit
TGTAAACATCCTTGACTGGAAGCT257330.2545030815711404No Hit
ACCATCGACCGTTGACTGTGCC252170.24939976714644418No Hit
TAGCTTATCAGACTGGTGTTGG249760.24701624238607245No Hit
TGTAAACATCCTACACTCTCAGCT242650.23998434983576425No Hit
TGCTCAGTAGTCAGTGTAGATCC229750.22722606377402363No Hit
ATCTACATCTGGCTACTGGGTCTC228150.22564364069659845No Hit
AGCTACATTGTCTGCTGGGTTTC216430.21405239165445894No Hit
AGCTACATTGTCTGCTGGGTTT213890.21154029501904642No Hit
AACATTCAACGCTGTCGGTGG206870.20459741376684343No Hit
TGAGATGAAGCACTGTAGCTC201500.1992864063132351No Hit
TCCAGCATCAGTGATTTTGTT197300.195132545734994No Hit
AAGGTCCAACCTCACATGTCCT195460.193312759195955No Hit
AACATTCAACGCTGTCGGTGAGTT188450.1863797680879859No Hit
AACATTCATTGCTGTCGGTGGGTT187310.18525229164532045No Hit
AGCTACATCTGGCTACTGGGTCTCT187210.18515339020298138No Hit
TGAGGTAGTTGGTTGTATTGTT187020.18496547746253714No Hit
TCCCTGAGACCCTTAACCTGTGG185530.1834918459716849No Hit
CACCACGTTCCCGTGG183700.18168194957687986No Hit
AGAATAATGCCAGCAGTCGGTC181540.17954567842235586No Hit
TGATGTAGTAGGTTGTATAGTT176570.17463027673810383No Hit
TACCCTGTAGAACCGAATTTGT172670.17077312048687993No Hit
TAAATCTAGAGAACCGAAAGTA171630.16974454548655354No Hit
ACCGTGGCTTTAGATTGTTACT168110.16626321471621813No Hit
TTCAAGTAATCCAGGATAGGC166330.16450276904258263No Hit
AGCAGCATTGTACAGGGCTATGA163320.16152583562817646No Hit
AATATTCAACGCTGTCGGTGAG162280.1604972606278501No Hit
TTCAAGTAATCCAGGATAGGTT161270.15949835606022544No Hit
TTGCATAGTCACAAAAATGAGC159920.15816318658864792No Hit
TGAGGTAGTAGGTTGTGTGGTT158790.15704560029021639No Hit
TGCTCAGTAGTCAGTGTAGATC156280.1545631740875056No Hit
AAGCTGCCAGTTGAAGAGCTGT154620.152921410144677No Hit
AACAGTCAACGCTGTCGGTGAG154410.15271371711576492No Hit
TTATGTAGTAGGTTGTATAGTT154040.15234778177911035No Hit
AAGCTGCCAGCTGAAGAACTGC151410.14974667384559268No Hit
CTTTGGTTATCTAGCTGTATGA151350.14968733298018924No Hit
TACCCTGTAGAACCGAATGTGT147650.1460279796136435No Hit
TCCCTGAGACCCTAACTTGTG140910.13936202239998988No Hit
TGAGATGAAGCACTGTAGCTCT131630.13018396855092376No Hit
AATATTCAACGCTGTCGGTGAGT131250.12980814307003527No Hit
TTCAAGTAATCCAGGATAGGCTT128600.1271872548480498No Hit
TACGCCTGTCTGAGGGTCGCT126300.12491252167425108No Hit
CATTATTACTTTTGGTACGCG125860.12447735532795917No Hit
GAAGGATCATTA125540.12416087071247413No Hit
AACAGTCAACGCTGTCGGTGAGT124280.1229147125390018No Hit
AAGCCCTTACCCCAAAAAGCAT123060.12170811494246507No Hit
CAGGCTGGTTAGATGGTTGTCT122600.12125316830770533No Hit
ACCACGTTCCCGTGG121160.11982898753802265No Hit
TGAGGTAGTAGGTTGTATAGTTT119780.11846414763374342No Hit
TTCCCTTTGTCATCCTATGCCT118800.1174949134988205No Hit
AACATTCATTGCTGTCGCTGGGTT118490.11718831902756938No Hit
ACCATTGACCGTTGACTGTACC116090.11481468441143158No Hit
TGAGGTAGTAGATTGAATAGTT115900.11462677167098734No Hit
AACATTCATTGCTGTCGCTGGGT115190.11392457143037991No Hit
AACATTCAACGCTGTCGGTGAGA114310.11305423873779606No Hit
TAACAGTCTACAGCCATGGTCG110240.10902895003459573No Hit
TTTGGCAATGGTAGAACTCACA108820.10762454955338087No Hit
CTTTTTGCGGTCTGGGCTTGC107830.10664542527422402No Hit
TTAGGTAGTAGGTTGTATAGTT106580.1054091572449856No Hit
TGTAAACATCCCCGACTGGAAGCT105870.10470695700437818No Hit
TAGCAGCGCATCATGGTTTGAT102470.10134430796484963No Hit
CAAGCTCGTATCTATAGGTATG101270.10015749065678074No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCCAGTC56.284022E-43608.181223
GATTCGT56.284022E-43608.181223
CAACCCG1600.03382.6723
TAACTAA750.03127.090323
TAACTGC1700.02759.197523
AATAACC1800.02706.13623
ACGCATA100.00251314561804.090623
GAGGGAT100.00251314561804.090623
CAACGGG50.0025925981776.740522
ACACCCG50.0025925981776.740522
AAGCAAC50.0025925981776.740522
ACAACCC4750.01720.632922
ATAACTA7900.01698.024322
CCAACCC600.01480.617222
TAACACA257.2339717E-61443.272623
ATAAAAA400.01332.555422
TCTGACT18650.01218.849523
TTCTATA150.0056535351202.72723
AGCAACC150.0056535351202.72723
GGAGACA150.0056535351202.72723