FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_5_JG25_1_CGATGT_L008_R1_001_TRIMMED_prinseq_good_vnWI.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_5_JG25_1_CGATGT_L008_R1_001_TRIMMED_prinseq_good_vnWI.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10332918
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG108612310.511290227987875No Hit
AACATTCAACGCTGTCGGTGAGT9270408.971715443788481No Hit
TTCAAGTAATCCAGGATAGGCT4293944.155592834473283No Hit
TCACAGTGAACCGGTCTCTTT3880703.7556670826188694No Hit
AACATTCAACGCTGTCGGTGA2326502.2515421103699844No Hit
CCTGTCTGAGGGTCGCT2148112.078899687387435No Hit
TGAGGTAGTAGGTTGTATAGTT1485471.4376093955260267No Hit
TCCCTGAGACCCTTAACCTGTGA1465701.4184763684372605No Hit
TAGCTTATCAGACTGGTGTTGGC1351581.3080332196577966No Hit
TCCCTGAGACCCTTAACCTGTG1345831.3024684798621262No Hit
TAAAGCTAGAGAACCGAAAGTA1016090.9833524276491888No Hit
TTAAAGGGAATTTGCGACTGTT936120.9059589943518375No Hit
AAGCTGCCAGCTGAAGAACTGT926780.8969199213620006No Hit
AGCTACATCTGGCTACTGGGTCTC875640.8474276095097242No Hit
AACATTCATTGCTGTCGGTGGGT868620.840633788054836No Hit
AACATTCATTGCTGTCGGTGGG850320.8229233987920933No Hit
CTGTCTGAGGGTCGCT832310.8054936659712193No Hit
TCTTTGGTTATCTAGCTGTATGA817320.7909866312691148No Hit
CTACGCCTGTCTGAGGGTCGCT684640.6625814702100606No Hit
TTCACAGTGGCTAAGTTCTGC611720.5920108917926185No Hit
TATTGCACTCGTCCCGGCCTCC595480.5762941310479769No Hit
TCTTTGGTTATCTAGCTGTAT568810.5504834162044061No Hit
TCACAGTGAACCGGTCTCTTTT566250.5480058972692903No Hit
TACCCTGTAGAACCGAATTTGT545900.5283115572967868No Hit
TGTCTGAGGGTCGCT541230.5237920208018684No Hit
TCCCTGAGACCCTAACTTGTGA537800.5204725325411467No Hit
TTCCCTTTGTCATCCTATGCCTG533320.5161368744046938No Hit
AGCTGGTGTTGTGAATCAGGCCG531820.5146852031536493No Hit
TCACAGTGAACCGGTCTCTT528580.5115495932513933No Hit
AACCCGTAGATCCGAACTTGTG524390.507494591556809No Hit
TCTTTGGTTATCTAGCTGTATG506400.4900842143526156No Hit
TTGCATAGTCACAAAAGTGATC502960.48675504828355365No Hit
CCACGTTCCCGTGG492740.47686432815977053No Hit
CCCTGAGACCCTTAACCTGTGA465500.4505019782408028No Hit
ACCTTGGCTTTAGACTGCTTACT458390.44362105651085204No Hit
TGAGGTAGTAGTTTGTATAGTT435600.42156533130331625No Hit
TCCAGCATCAGTGATTTTGTTG407790.3946513463089517No Hit
TATTGCACTTGTCCCGGCCTGT399820.3869381330617353No Hit
TGAGGTAGTTGGTTGTATAGTT382780.3704471476498701No Hit
TACCCTGTAGATCCGGATTTGT378440.36624697883018137No Hit
TAACAGTCTACAGTCATGGCT369150.3572562948820459No Hit
TAAAGGGAATTTGCGACTGTT336810.325958262709527No Hit
TAAAGCTAGAGAACCGAAAGT319640.3093414657892379No Hit
TTCACAGTGGCTAAGTTCTG315050.30489935176104177No Hit
CCTTTCTGAGGGTCGCT314800.3046574065525343No Hit
TCCCTGAGACCCTTAACCTGT303490.29371180531965896No Hit
TACCCTGTAGAACCGAATTTGCG301710.2919891554350862No Hit
AACATTCAACGCTGTCGGTGG298380.28876644525776746No Hit
AGCTACATCTGGCTACTGGGTCT284240.27508202426458817No Hit
TAGCTTATCAGACTGGTGTTGG277540.2685978926765895No Hit
TGTAAACATCCTTGACTGGAAGCT275680.26679782032529437No Hit
AACATTCATTGCTGTCGGTGGGTT272680.2638944778232054No Hit
TACCCTGTAGAACCGAATGTGT271600.2628492745224534No Hit
AAGCTGCCAGCTGAAGAACT271530.26278152986407133No Hit
AACATTCAACGCTGTCGGTGAGTT266130.2575555133603112No Hit
TACCCTGTAGATCCGGATTTGTG265010.256471598826198No Hit
TTGGTCCCCTTCAACCAGCTGT263040.2545650705831596No Hit
TGTAAACATCCTACACTCTCAGCT262430.2539747242744015No Hit
TGAGGTAGTAGTTTGTGCTGTT260050.2516714058894109No Hit
ACCATCGACCGTTGACTGTACC257020.24873902996230107No Hit
TCCCTGAGACCCTTAACCTGTGG244740.23685468132041693No Hit
TAAATCTAGAGAACCGAAAGTA234660.22709945051339803No Hit
TTCAAGTAATCCAGGATAGGTT233840.22630587022949375No Hit
AAGGTCCAACCTCACATGTCCT229600.222202479493208No Hit
CACCACGTTCCCGTGG217180.21018264153455976No Hit
TCTTTGGTTATCTAGCTGTATGT216530.20955358399244048No Hit
AGAATAATGCCAGCAGTCGGTC214930.20800513465799303No Hit
AACAGTCAACGCTGTCGGTGAG214630.20771480040778414No Hit
TGAGATGAAGCACTGTAGCTC214310.20740511054089464No Hit
AAGCTGCCAGTTGAAGAGCTGT211580.2047630688639937No Hit
ACCATCGACCGTTGACTGTGCC206070.19943059646849032No Hit
ATCTACATCTGGCTACTGGGTCTC205700.19907251755989933No Hit
TACCCTGTAGAACCGAATTTGC201660.19516268299041956No Hit
TGAGGTAGTTGGTTGTATTGTT200470.1940110237979243No Hit
TCCAGCATCAGTGATTTTGTT196670.1903334566286116No Hit
TGAGGTAGTAGGTTGTATAGT191290.18512679574153207No Hit
AACAGTCAACGCTGTCGGTGAGT184930.1789717096371035No Hit
ACCACGTTCCCGTGG183660.17774262797788581No Hit
GAAGGATCATTA169880.16440660808495722No Hit
TTCAAGTAATCCAGGATAGGC168060.16264524696702326No Hit
AATATTCAACGCTGTCGGTGAG166770.161396809691125No Hit
CACGTTCCCGTGG166130.160777429957346No Hit
AGCAGCATTGTACAGGGCTATGA160500.15532882386175909No Hit
TAGCAGCACGTAAATATTGGAG159190.15406103096918022No Hit
AACATTCAACGCTGTCGGTGAGA152090.14718978704756971No Hit
TTTGGTCCCCTTCAACCAGCTGT150860.14599941662171326No Hit
TGAGATGAAGCACTGTAGCTCT148460.1436767426200421No Hit
CTACTCCTGTCTGAGGGTCGCT146910.1421766823272961No Hit
ACCGTGGCTTTAGATTGTTACT146540.14181860341870514No Hit
TACGCCTGTCTGAGGGTCGCT145770.14107341217650232No Hit
AATATTCAACGCTGTCGGTGAGT144010.13937011790861015No Hit
CTTTGGTTATCTAGCTGTATGA142370.1377829573408015No Hit
TAACAGTCTACAGCCATGGTCG141790.1372216444570643No Hit
CCTGTCTGAGGGTCGCTT141060.13651516444822268No Hit
AGCTACATTGTCTGCTGGGTTT140090.1355764170392139No Hit
AGCTACATCTGGCTACTGGGTCTCT139400.13490864826373344No Hit
AGCTACATTGTCTGCTGGGTTTC136650.1322472509701519No Hit
TTCAAGTAATCCAGGATAGGCTT136410.13201498356998478No Hit
TAATCTCTGCAGGCAACTGTGA136180.13179239397815795No Hit
AAGCTGCCAGCTGAAGAACTGC133640.12933423065972263No Hit
TGCTCAGTAGTCAGTGTAGATCC131830.12758254735012897No Hit
AACATTCAACGCTGTCGGTG126370.12229846399632709No Hit
TTGCATAGTCACAAAAATGAGC125600.12155327275412424No Hit
AACATTCATTGCTGTCGCTGGGTT125250.12121454946221386No Hit
ACCATTGACCGTTGACTGTACC124450.12044032479499014No Hit
TGTAAACATCCCCGACTGGAAGCT123390.11941447711091872No Hit
CAGGCTGGTTAGATGGTTGTCT123310.11933705464419635No Hit
AACATTCATTGCTGTCGCTGGGT122690.11873703052709796No Hit
TCCCTGAGACCCTAACTTGTG122250.11831120696012491No Hit
CATTATTACTTTTGGTACGCG117260.11348198059831696No Hit
AAGCCCTTACCCCAAAAAGCAT116820.1130561570313439No Hit
TTCCCTTTGTCATCCTATGCCT111530.10793659641932704No Hit
AACATTCAACGCTGTCGGTGAGTTT108770.10526552131740521No Hit
CCACTTTCCCGTGG108650.10514938761732166No Hit
CTTTTTGCGGTCTGGGCTTGC108360.10486873117545306No Hit
CCCTTAGACCCTTAACCTGTGA107790.10431709610005614No Hit
TGATGTAGTAGGTTGTATAGTT105540.10213958922348942No Hit
ACCCTGTAGAACCGAATTTGCG105150.10176215469821788No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTCGAAA54.5875556E-44222.65623
GGGTACT54.5875556E-44222.65623
CAACCCG1000.04222.65623
GCACCCT54.5875556E-44222.65623
TCACTAA54.5875556E-44222.65623
ACACTAA54.5875556E-44222.65623
TAACTGC900.03518.8823
AATAACC1400.03317.80123
TAACTAA350.03016.182623
CGGAATA100.00183473332111.32823
AGGTAGA100.00183473332111.32823
GCAAAAG100.00183473332111.32823
GGTCACA100.00183473332111.32823
TAGGCCA100.00183473332111.32823
AACGTCT50.00185279772101.699722
CCTAGCC50.00185279772101.699722
GTAGGCC50.00185279772101.699722
TGGATAC50.00185279772101.699722
ATAACGG50.00185279772101.699722
CCCGGGA50.00185279772101.699722