FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_5_JG35_1_TTAGGC_L001_R1_001_TRIMMED_prinseq_good_l33B.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_5_JG35_1_TTAGGC_L001_R1_001_TRIMMED_prinseq_good_l33B.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6675144
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG69919610.474620472607032No Hit
AACATTCAACGCTGTCGGTGAGT5816398.713504907160056No Hit
TCACAGTGAACCGGTCTCTTT2808094.206785651365723No Hit
TTCAAGTAATCCAGGATAGGCT2439163.654093454762924No Hit
AACATTCAACGCTGTCGGTGA1715772.5703864965310115No Hit
CCTGTCTGAGGGTCGCT1167291.7487113386617577No Hit
TGAGGTAGTAGGTTGTATAGTT1118411.6754844539683338No Hit
TCCCTGAGACCCTTAACCTGTG866501.2980993368832194No Hit
TCCCTGAGACCCTTAACCTGTGA855941.2822794534469968No Hit
AGCTACATCTGGCTACTGGGTCTC787531.1797947729666955No Hit
TAGCTTATCAGACTGGTGTTGGC669231.0025701318203772No Hit
TAAAGCTAGAGAACCGAAAGTA564180.8451952497204553No Hit
AAGCTGCCAGCTGAAGAACTGT556730.8340344418038023No Hit
TTAAAGGGAATTTGCGACTGTT523570.7843576108620279No Hit
TGAGGTAGTAGTTTGTGCTGTT518920.7773914690080095No Hit
CTACGCCTGTCTGAGGGTCGCT518450.7766873643474957No Hit
AACATTCATTGCTGTCGGTGGGT506550.7588600335812979No Hit
CTGTCTGAGGGTCGCT504390.7556241483329798No Hit
TCTTTGGTTATCTAGCTGTATGA467270.7000148611026219No Hit
AACATTCATTGCTGTCGGTGGG464520.6958950997911056No Hit
CCACGTTCCCGTGG458710.6871911677111385No Hit
TCACAGTGAACCGGTCTCTTTT458240.6864870630506248No Hit
TATTGCACTCGTCCCGGCCTCC448220.6714761509264819No Hit
TCACAGTGAACCGGTCTCTT400920.600616256368402No Hit
AGCTGGTGTTGTGAATCAGGCCG348930.5227302961554088No Hit
TGTCTGAGGGTCGCT345720.5179214111336026No Hit
TGAGGTAGTAGTTTGTATAGTT342300.5127979261570986No Hit
TTCCCTTTGTCATCCTATGCCTG330830.4956147762505198No Hit
TCTTTGGTTATCTAGCTGTAT304860.45670924851958256No Hit
TCCCTGAGACCCTAACTTGTGA303710.4549864392438575No Hit
TCTTTGGTTATCTAGCTGTATG291720.4370242799256466No Hit
CCCTGAGACCCTTAACCTGTGA278050.4165453209698547No Hit
TTCACAGTGGCTAAGTTCTGC277490.41570638775732777No Hit
AACCCGTAGATCCGAACTTGTG270000.4044856560397798No Hit
TACCCTGTAGAACCGAATTTGT257180.3852800778530021No Hit
TTGCATAGTCACAAAAGTGATC239000.3580447103463236No Hit
TGAGGTAGTTGGTTGTATAGTT236790.3547339203468869No Hit
TATTGCACTTGTCCCGGCCTGT231070.346164816818933No Hit
AACATTCAACGCTGTCGGTGG223740.3351837803049642No Hit
ACCTTGGCTTTAGACTGCTTACT216830.3248319437003906No Hit
AGCTACATCTGGCTACTGGGTCT212010.31761112569256933No Hit
TCCAGCATCAGTGATTTTGTTG208340.31211311696047306No Hit
TCCCTGAGACCCTTAACCTGT205040.30716940338665355No Hit
TAACAGTCTACAGTCATGGCT200820.300847442392254No Hit
AAGCTGCCAGCTGAAGAACT197860.29641308112604015No Hit
TAAAGGGAATTTGCGACTGTT197750.2962482906735795No Hit
TACCCTGTAGAACCGAATGTGT181860.27244356076812726No Hit
TAAAGCTAGAGAACCGAAAGT179140.268368742307282No Hit
TTCACAGTGGCTAAGTTCTG174740.261777124208856No Hit
TAGCAGCACGTAAATATTGGAG173120.25935021027261734No Hit
CCTTTCTGAGGGTCGCT171550.2569982010874971No Hit
TCCCTGAGACCCTTAACCTGTGG166150.24890848796670154No Hit
TGTAAACATCCTACACTCTCAGCT165530.2479796690528324No Hit
AACAGTCAACGCTGTCGGTGAG162180.24296105072789442No Hit
TACCCTGTAGATCCGGATTTGT160180.2399648606831553No Hit
TACCCTGTAGAACCGAATTTGCG158830.23794243240295637No Hit
AACATTCAACGCTGTCGGTGAGTT158660.2376877562491536No Hit
TGAGGTAGTAGGTTGTATAGT156160.23394251869322968No Hit
ACCACGTTCCCGTGG152450.22838458616023863No Hit
ACCATCGACCGTTGACTGTACC147470.22092407294883823No Hit
AGAATAATGCCAGCAGTCGGTC145620.21815259715745458No Hit
AACATTCATTGCTGTCGGTGGGTT142540.21353846448855635No Hit
TAGCTTATCAGACTGGTGTTGG138180.2070067701910251No Hit
ACCATCGACCGTTGACTGTGCC136300.20419035154897033No Hit
CACGTTCCCGTGG135860.20353118973912773No Hit
AACAGTCAACGCTGTCGGTGAGT132270.19815302860882103No Hit
GAAGGATCATTA129870.1945576005551341No Hit
TCTTTGGTTATCTAGCTGTATGT128820.19298460078164606No Hit
TGTAAACATCCTTGACTGGAAGCT124850.18703716354283892No Hit
AAGCTGCCAGTTGAAGAGCTGT123690.18529937331689023No Hit
TACCCTGTAGATCCGGATTTGTG122930.18416082109988938No Hit
TGAGGTAGTTGGTTGTATTGTT121510.1820335261681246No Hit
TTCAAGTAATCCAGGATAGGTT119720.1793519360780831No Hit
AGCTACATCTGGCTACTGGGTCTCT112540.1685956138174697No Hit
TGATGTAGTAGGTTGTATAGTT112070.167891509156956No Hit
AACATTCAACGCTGTCGGTGAGA109790.16447585250595342No Hit
AATATTCAACGCTGTCGGTGAG108640.16275304323022843No Hit
TACGCCTGTCTGAGGGTCGCT106360.15933738657922586No Hit
AGCAGCATTGTACAGGGCTATGA105080.1574198249505928No Hit
AACTTTCAACGCTGTCGGTGAG104840.15706028214522413No Hit
TGAGATGAAGCACTGTAGCTC104470.1565059869869474No Hit
TCCAGCATCAGTGATTTTGTT104120.15598165372911807No Hit
CACCACGTTCCCGTGG100320.15028889264411374No Hit
AGCTACATTGTCTGCTGGGTTTC98390.1473975692509405No Hit
TGCTCAGTAGTCAGTGTAGATCC98070.14691817884378225No Hit
TTCAAGTAATCCAGGATAGGCTT96890.14515042671738618No Hit
TTCAAGTAATCCAGGATAGGC95250.1426935508807001No Hit
AGCTACATTGTCTGCTGGGTTT94900.14216921762287077No Hit
ACCGTGGCTTTAGATTGTTACT94810.1420343890708575No Hit
TGAGGTAGTAGGTTGTGTGGTT94740.14192952241929163No Hit
ATCTACATCTGGCTACTGGGTCTC91650.1373004088001697No Hit
AACATTCAACGCTGTCGGTG89900.134678742511023No Hit
TACCCTGTAGAACCGAATTTGC89320.13380984739804863No Hit
AATATTCAACGCTGTCGGTGAGT88820.13306079988686387No Hit
AAGGTCCAACCTCACATGTCCT88250.13220688572411324No Hit
AACTTTCAACGCTGTCGGTGAGT87460.13102339065644128No Hit
AACGTTCAACGCTGTCGGTGAG86270.1292406575798215No Hit
TGAGATGAAGCACTGTAGCTCT85270.12774256255745195No Hit
CAGGCTGGTTAGATGGTTGTCT84190.12612461993329283No Hit
AAGCTGCCAGCTGAAGAACTGC83970.12579503902837152No Hit
TAAATCTAGAGAACCGAAAGTA83550.12516583911897633No Hit
AAGCCCTTACCCCAAAAAGCAT83300.12479131536338392No Hit
TAACAGTCTACAGCCATGGTCG82340.12335314414190915No Hit
CTTTGGTTATCTAGCTGTATGA81470.12204980147244764No Hit
TAGCAGCGCATCATGGTTTGAT77300.1158027452291666No Hit
AACATTCATTGCTGTCGCTGGGT76550.11467917396238943No Hit
AACATTCATTGCTGTCGCTGGGTT76510.11461925016149466No Hit
CTACTCCTGTCTGAGGGTCGCT76020.11388518360053357No Hit
TCCCTGAGACCCTAACTTGTG75940.113765335998744No Hit
CCACTTTCCCGTGG75540.11316609798979617No Hit
TGTAAACATCCCCGACTGGAAGCT74570.1117129458180977No Hit
TTAGGTAGTAGGTTGTATAGTT69240.10372809934886798No Hit
AACGTTCAACGCTGTCGGTGAGT69230.10371311839864428No Hit
ACCATTGACCGTTGACTGTACC69110.10353334699595992No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGAGAT59.750467E-42896.216323
AGTACCA59.750467E-42896.216323
CAACCCG1850.02583.111823
AATAACC950.02438.919223
TAACTAA700.02275.598623
TAACTGC1400.02068.72623
TAACTTA351.0913936E-111654.980823
CGTGGTG100.00389929191448.108223
CGGGGAT100.00389929191448.108223
CATAGCT100.00389929191448.108223
CAAGGGC100.00389929191448.108223
GCAGGGA207.1564627E-61448.108223
GATTCCT800.01448.108223
CGCCCTA100.00389929191448.108223
CATATAA50.00403297931424.401122
GACGTCC50.00403297931424.401122
ACGTGGT50.00403297931424.401122
TCTCCTA50.00403297931424.401122
TTTTCCT50.00403297931424.401122
ACGAAGT50.00403297931424.401122