FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_7_JG48_1_GCCAAT_L008_R1_001_TRIMMED_prinseq_good_nniI.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_7_JG48_1_GCCAAT_L008_R1_001_TRIMMED_prinseq_good_nniI.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11729366
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG128285210.937095832801193No Hit
AACATTCAACGCTGTCGGTGAGT9488808.089780811682406No Hit
TTCAAGTAATCCAGGATAGGCT5719024.875813407135561No Hit
TCACAGTGAACCGGTCTCTTT4453563.796931564758061No Hit
AACATTCAACGCTGTCGGTGA2607172.222771460963875No Hit
TGAGGTAGTAGGTTGTATAGTT1863461.5887133200549801No Hit
TTAAAGGGAATTTGCGACTGTT1375501.1726976547581516No Hit
TCCCTGAGACCCTTAACCTGTG1337221.140061619698797No Hit
TAGCTTATCAGACTGGTGTTGGC1231031.0495281671660683No Hit
TAAAGCTAGAGAACCGAAAGTA1173701.0006508450669882No Hit
TTGCATAGTCACAAAAGTGATC1162450.9910595338230558No Hit
CCTGTCTGAGGGTCGCT1125870.9598728524627844No Hit
AACATTCATTGCTGTCGGTGGG1111320.9474680899206316No Hit
TCCCTGAGACCCTTAACCTGTGA1098100.9361972335077616No Hit
AGCTACATCTGGCTACTGGGTCTC1003040.8551527848990303No Hit
AACATTCATTGCTGTCGGTGGGT923340.7872036732420149No Hit
AAGCTGCCAGCTGAAGAACTGT922150.7861891256526569No Hit
TCTTTGGTTATCTAGCTGTATGA911530.7771349278383844No Hit
TCACAGTGAACCGGTCTCTTTT758170.6463861729610961No Hit
TACCCTGTAGAACCGAATTTGT750960.6402392081549847No Hit
TCTTTGGTTATCTAGCTGTAT734090.6258565040940832No Hit
TCACAGTGAACCGGTCTCTT713810.6085665670250209No Hit
TATTGCACTCGTCCCGGCCTCC702650.5990519862710397No Hit
TTCACAGTGGCTAAGTTCTGC656750.559919436395795No Hit
ACCTTGGCTTTAGACTGCTTACT578380.49310423086806227No Hit
TTCACAGTGGCTAAGTTCTG577910.4927035271983157No Hit
TAACAGTCTACAGTCATGGCT576050.49111776373931887No Hit
TACCCTGTAGAACCGAATGTGT575800.49090462348945374No Hit
TGAGGTAGTAGTTTGTGCTGTT572160.4878013014514169No Hit
TCTTTGGTTATCTAGCTGTATG562610.47965934390656756No Hit
AACCCGTAGATCCGAACTTGTG555390.4735038534904615No Hit
TACCCTGTAGATCCGGATTTGT523650.44644356736757984No Hit
AGCTGGTGTTGTGAATCAGGCCG523200.44605991491782254No Hit
TAAAGGGAATTTGCGACTGTT500120.42638280705027026No Hit
TGAGGTAGTAGTTTGTATAGTT494380.421489106913366No Hit
TTCCCTTTGTCATCCTATGCCTG490020.41777194095571746No Hit
TAAAGCTAGAGAACCGAAAGT482710.41153972004966No Hit
TCCCTGAGACCCTAACTTGTGA472450.40279244419519344No Hit
AAGCTGCCAGCTGAAGAACT441200.3761499129620476No Hit
TCCAGCATCAGTGATTTTGTTG423200.3608038149717555No Hit
CCCTGAGACCCTTAACCTGTGA407880.34774258046001805No Hit
TACCCTGTAGAACCGAATTTGCG371770.3169566027694933No Hit
TCCCTGAGACCCTTAACCTGT365860.3119179672626807No Hit
AGCTACATCTGGCTACTGGGTCT358680.30579657928655307No Hit
CTGTCTGAGGGTCGCT354980.3026421035885486No Hit
TGAGGTAGTTGGTTGTATAGTT345200.2943040570138233No Hit
TATTGCACTTGTCCCGGCCTGT344110.2933747655244111No Hit
AACTCCAGTCACGCCAATATCTCGTATGC340960.29068919837611Illumina PCR Primer Index 6 (100% over 29bp)
AACATTCAACGCTGTCGGTGG340640.29041637885628263No Hit
TATGGCTTTTTATTCCTATCTG328760.2802879541826898No Hit
TCCAGCATCAGTGATTTTGTT328370.2799554553929002No Hit
TGTAAACATCCTTGACTGGAAGCT290590.2477457008332761No Hit
TCTTTGGTTATCTAGCTGTATGT278090.23708868834001767No Hit
TAGCAGCACGTAAATATTGGAG272670.23246780772294087No Hit
TAAATCTAGAGAACCGAAAGTA268020.22850339907544875No Hit
AGAATAATGCCAGCAGTCGGTC267160.22777019661591258No Hit
TACCCTGTAGAACCGAATTTGC264620.22560469167728245No Hit
AACAGTCAACGCTGTCGGTGAG254860.21728369632254635No Hit
CTACGCCTGTCTGAGGGTCGCT253180.2158513938434524No Hit
TTCAAGTAATCCAGGATAGGC250180.21329371084507037No Hit
TACCCTGTAGATCCGGATTTGTG249710.2128930071753239No Hit
ACCATCGACCGTTGACTGTGCC249210.21246672667559352No Hit
TGAGATGAAGCACTGTAGCTC243780.2078373204485221No Hit
TAGCTTATCAGACTGGTGTTGG239240.20396669351097066No Hit
ACCATCGACCGTTGACTGTACC238660.20347220813128347No Hit
TTCAAGTAATCCAGGATAGGTT235850.20107651172279903No Hit
AACTCCAGTCACGCCAATATCT235290.20059907756310105Illumina PCR Primer Index 6 (100% over 22bp)
AACATTCATTGCTGTCGGTGGGTT232740.19842504701447633No Hit
TGAGGTAGTAGGTTGTATAGT230480.1964982591556952No Hit
TTGCATAGTCACAAAAATGAGC229670.19580768474613208No Hit
ATCTACATCTGGCTACTGGGTCTC229480.19564569815623453No Hit
AAGCTGCCAGTTGAAGAGCTGT222070.18932822115023096No Hit
TGCTCAGTAGTCAGTGTAGATCC215550.1837695234337474No Hit
ACCGTGGCTTTAGATTGTTACT214750.18308747463417888No Hit
TGTCTGAGGGTCGCT209750.17882466963687552No Hit
AACATTCAACGCTGTCGGTGAGTT205690.1753632719790652No Hit
AGCTACATTGTCTGCTGGGTTTC199680.17023938037230657No Hit
AAGGTCCAACCTCACATGTCCT197770.1686109888633367No Hit
AGCTACATTGTCTGCTGGGTTT196440.16747708273405398No Hit
TCCCTGAGACCCTTAACCTGTGG194080.1654650387753268No Hit
TGTAAACATCCTACACTCTCAGCT187910.16020473740865449No Hit
AATATTCAACGCTGTCGGTGAG186840.15929249713923158No Hit
TATGGCTTTTTATTCCTATCTGA186470.15897704956943112No Hit
AACATTCAACGCTGTCGGTGAGA185870.15846551296975472No Hit
TTCAAGTAATCCAGGATAGGCTT185780.15838878247980326No Hit
AACAGTCAACGCTGTCGGTGAGT185530.1581756422299381No Hit
AGCAGCATTGTACAGGGCTATGA185190.15788577149012145No Hit
CATTATTACTTTTGGTACGCG179660.15317110916310397No Hit
TGAGATGAAGCACTGTAGCTCT177650.15145746155418802No Hit
TAACAGTCTACAGCCATGGTCG175650.14975233955526668No Hit
TGCTCAGTAGTCAGTGTAGATC173840.14820920414624286No Hit
CTTTGGTTATCTAGCTGTATGA170860.14566857236785008No Hit
TACCCTGTAGAACCGAATGTGTG168460.14362242596914446No Hit
CCTTTCTGAGGGTCGCT164690.14040827100117773No Hit
AACATTCAACGCTGTCGGTG164060.13987115757151752No Hit
CCACGTTCCCGTGG163030.138993019742073No Hit
TTCCCTTTGTCATCCTATGCCT162600.13862641851230495No Hit
CAGGCTGGTTAGATGGTTGTCT162140.13823424045255303No Hit
AAGCTGCCAGCTGAAGAACTGC158800.1353866867143544No Hit
TGAGGTAGTTGGTTGTATTGTT153780.13110683049706182No Hit
TCTTTGGTTATCTAGCTGTA151140.12885606945848566No Hit
CCTTGGCTTTAGACTGCTTACT148900.12694633281969375No Hit
TAAGGCACGCGGTGAATGCC145000.12362134492179713No Hit
AACTCCAGTCACGCCAATATCTCG142030.12108923875339896Illumina PCR Primer Index 6 (100% over 24bp)
AATATTCAACGCTGTCGGTGAGT140440.11973366676425648No Hit
AAGCCCTTACCCCAAAAAGCAT137040.1168349593660902No Hit
AACATTCATTGCTGTCGCTGGGT134800.11492522272729831No Hit
AGCTACATCTGGCTACTGGGTCTCT133260.11361227878812886No Hit
ACCATCGACCGTTGACTGTGCCT130230.11102901895976304No Hit
TGTAAACATCCCCGACTGGAAGCT129630.11051748236008663No Hit
TCCCTGAGACCCTAACTTGTG129120.1100826762503617No Hit
TGATGTAGTAGGTTGTATAGTT128510.10956261404069069No Hit
CTTTTTGCGGTCTGGGCTTGC125380.1068940981123788No Hit
TGAGTTAGTAGGTTGTATAGTT124010.10572608954311767No Hit
CACCACGTTCCCGTGG123310.10512929684349522No Hit
TAAATGGAATTTGCGACTGTT122380.10433641511399679No Hit
TGAGATGAAGCACTGTAGCT122380.10433641511399679No Hit
ACCATTGACCGTTGACTGTACC121160.10329629069465478No Hit
ACCCTGTAGAACCGAATTTGCG119600.1019662955354961No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATTC104.213238E-61729.49923
CGTATAC50.00273640381729.49923
CGCCCCA50.00273640381729.49923
CGTATGC37300.01701.678723
CAACCCG2600.01496.681823
TAACTGC1650.01467.453923
GATTCCT7000.01358.892123
AATAACC2150.01327.2923
TAACTAA1200.01297.124323
GTATGCC550.01257.817523
CGCATTG500.01210.649423
GTTTAAC101.8390876E-51058.254822
ATCACTA50.0073082361058.254822
TCCCACG50.0073082361058.254822
TCGTATG38350.01037.558822
ATAACTA14400.01017.8352722
ACAACCC6750.0995.5433322
TAATAAC2750.0827.362822
GGATTCC9450.0823.0870422
TCTGACT19350.0799.949223