FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_7_JG53_1_CAGATC_L001_R1_001_TRIMMED_prinseq_good_spyt.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_7_JG53_1_CAGATC_L001_R1_001_TRIMMED_prinseq_good_spyt.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18840589
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG191937410.187441592192261No Hit
AACATTCAACGCTGTCGGTGAGT15347638.146045752603595No Hit
TTCAAGTAATCCAGGATAGGCT7782924.130932424671012No Hit
TCACAGTGAACCGGTCTCTTT6860813.64150505061174No Hit
AACATTCAACGCTGTCGGTGA3853522.045328837649396No Hit
TGAGGTAGTAGGTTGTATAGTT3306251.7548549039523127No Hit
TAAAGCTAGAGAACCGAAAGTA2242001.189984028630952No Hit
TAGCTTATCAGACTGGTGTTGGC2146271.1391735152229052No Hit
TTAAAGGGAATTTGCGACTGTT2043491.0846210805829903No Hit
TCCCTGAGACCCTTAACCTGTG1909341.013418423383685No Hit
TCCCTGAGACCCTTAACCTGTGA1649700.8756095682571283No Hit
CCTGTCTGAGGGTCGCT1606760.8528183487257219No Hit
AACATTCATTGCTGTCGGTGGG1501380.7968859147662528No Hit
TTGCATAGTCACAAAAGTGATC1387890.7366489444677128No Hit
AACATTCATTGCTGTCGGTGGGT1319520.7003602700531284No Hit
TCTTTGGTTATCTAGCTGTATGA1209180.6417952220071251No Hit
TACCCTGTAGAACCGAATTTGT1154750.6129054670212274No Hit
AAGCTGCCAGCTGAAGAACTGT1138430.6042433174461797No Hit
TCACAGTGAACCGGTCTCTTTT1131560.6005969346287422No Hit
TTCACAGTGGCTAAGTTCTGC1027570.5454022695362656No Hit
TCACAGTGAACCGGTCTCTT1016350.5394470417034203No Hit
TGAGGTAGTAGTTTGTATAGTT931060.49417775633235245No Hit
TCTTTGGTTATCTAGCTGTAT925670.49131691158912283No Hit
AGCTACATCTGGCTACTGGGTCTC900750.4780901488801651No Hit
AGCTGGTGTTGTGAATCAGGCCG886080.4703037681040651No Hit
TATTGCACTCGTCCCGGCCTCC872090.4628783102269255No Hit
TGAGGTAGTAGTTTGTGCTGTT865260.45925315816825046No Hit
TTCCCTTTGTCATCCTATGCCTG839160.44540008807580267No Hit
TAAAGCTAGAGAACCGAAAGT837720.4446357807603573No Hit
AACCCGTAGATCCGAACTTGTG827790.43936524489759843No Hit
TACCCTGTAGATCCGGATTTGT785510.41692433288577124No Hit
TAAAGGGAATTTGCGACTGTT778820.4133734884827645No Hit
TAACAGTCTACAGTCATGGCT757690.4021583401665415No Hit
TCTTTGGTTATCTAGCTGTATG738830.3921480374100831No Hit
TCCAGCATCAGTGATTTTGTTG731020.38800273176172995No Hit
TTCACAGTGGCTAAGTTCTG721940.38318334952267147No Hit
TCCCTGAGACCCTAACTTGTGA700930.3720318934827356No Hit
TACCCTGTAGAACCGAATGTGT682900.36246212897059643No Hit
CTACGCCTGTCTGAGGGTCGCT669570.3553869786130359No Hit
CTGTCTGAGGGTCGCT665070.3529985182522691No Hit
ACCTTGGCTTTAGACTGCTTACT657210.348826674155463No Hit
TATTGCACTTGTCCCGGCCTGT610160.32385399416122285No Hit
TACCCTGTAGAACCGAATTTGCG588060.31212399994501233No Hit
CCCTGAGACCCTTAACCTGTGA574520.30493738810394944No Hit
TGAGGTAGTTGGTTGTATAGTT550250.29205562522488016No Hit
TCCCTGAGACCCTTAACCTGT505780.2684523291708131No Hit
AACAGTCAACGCTGTCGGTGAG505020.268048944754328No Hit
AAGCTGCCAGCTGAAGAACT503910.2674597911986722No Hit
TCCAGCATCAGTGATTTTGTT487980.25900464152155755No Hit
TGTAAACATCCTTGACTGGAAGCT487680.25884541083083973No Hit
TGTCTGAGGGTCGCT456790.2424499573765979No Hit
TACCCTGTAGATCCGGATTTGTG446920.23721126765198264No Hit
AAGGTCCAACCTCACATGTCCT437540.23223265472220642No Hit
TAGCAGCACGTAAATATTGGAG414420.21996127615755537No Hit
AGAATAATGCCAGCAGTCGGTC408840.21699958531020447No Hit
TACCCTGTAGAACCGAATTTGC406640.215831893578274No Hit
AACATTCAACGCTGTCGGTGG405620.21529050922983353No Hit
TAGCTTATCAGACTGGTGTTGG402880.21383620225461103No Hit
AACAGTCAACGCTGTCGGTGAGT397280.21086389602787894No Hit
AACTCCAGTCACCAGATCATCT394970.20963781970935197Illumina PCR Primer Index 7 (100% over 22bp)
TTCAAGTAATCCAGGATAGGTT389840.20691497489807778No Hit
AACATTCAACGCTGTCGGTGAGTT383150.20336413049507107No Hit
AAGCTGCCAGTTGAAGAGCTGT381070.2022601310394277No Hit
AACATTCATTGCTGTCGGTGGGTT368900.19580067268597598No Hit
TCTTTGGTTATCTAGCTGTATGT366800.19468605785095147No Hit
AGCTACATCTGGCTACTGGGTCT362530.19241967435306825No Hit
TTCAAGTAATCCAGGATAGGC361760.19201098224689261No Hit
ACCATCGACCGTTGACTGTACC360680.19143775176030856No Hit
TGAGGTAGTAGGTTGTATAGT359670.19090167510155867No Hit
TGAGATGAAGCACTGTAGCTC352990.18735613838824253No Hit
TGATGTAGTAGGTTGTATAGTT352970.18734552300886134No Hit
TAAATCTAGAGAACCGAAAGTA351940.18679883097073027No Hit
TTGCATAGTCACAAAAATGAGC345330.18329044808524828No Hit
TGTAAACATCCTACACTCTCAGCT329740.17501575985761378No Hit
AACTTTCAACGCTGTCGGTGAG324190.17206999207933468No Hit
ACCATCGACCGTTGACTGTGCC322950.17141183855770115No Hit
AGCAGCATTGTACAGGGCTATGA314770.16707014839079606No Hit
AATATTCAACGCTGTCGGTGAG285510.15153984835612094No Hit
TTCAAGTAATCCAGGATAGGCTT279210.14819600385104734No Hit
TTCCCTTTGTCATCCTATGCCT267840.1421611606728431No Hit
AACATTCAACGCTGTCGGTGAGA260850.1384510855791186No Hit
TGAGGTAGTTGGTTGTATTGTT258210.137049855500802No Hit
AACGTTCAACGCTGTCGGTGAG255920.13583439456165622No Hit
TGAGATGAAGCACTGTAGCTCT255220.13546285628331473No Hit
AACTTTCAACGCTGTCGGTGAGT252670.13410939541221348No Hit
CCTTTCTGAGGGTCGCT250050.13271878071327814No Hit
AAGCCCTTACCCCAAAAAGCAT249790.1325807807813227No Hit
CTTTGGTTATCTAGCTGTATGA247810.13152985822258528No Hit
CATTATTACTTTTGGTACGCG247720.13148208901536995No Hit
ACCGTGGCTTTAGATTGTTACT244710.12988447441850146No Hit
TCCCTGAGACCCTTAACCTGTGG243970.1294917053813976No Hit
CCACGTTCCCGTGG241500.1281807060278211No Hit
AACATTCAACGCTGTCGGTG237150.12587186101241313No Hit
CAGGCTGGTTAGATGGTTGTCT230430.12230509354033464No Hit
TTAGGTAGTAGGTTGTATAGTT226090.12000155621461728No Hit
AACTCCAGTCACCAGATCATCTCG225240.11955040259091687Illumina PCR Primer Index 7 (100% over 24bp)
AATATTCAACGCTGTCGGTGAGT224120.11895594134557046No Hit
TTGGTCCCCTTCAACCAGCTGT223010.11836678778991463No Hit
TAACAGTCTACAGCCATGGTCG212420.11274594440757663No Hit
TAATCTCTGCAGGCAACTGTGA205040.10882886941591899No Hit
AGCTACATTGTCTGCTGGGTTT202930.10770894689120387No Hit
AGCTACATTGTCTGCTGGGTTTC200840.10659963974586995No Hit
TGAGGTAGTAGGTTGTATAGTTT200780.10656779360772638No Hit
AACGTTCAACGCTGTCGGTGAGT200090.10620156301907548No Hit
TACCCTGTAGAACCGAATGTGTG195040.103521179725326No Hit
TGTAAACATCCCCGACTGGAAGCT193270.10258171865009102No Hit
TCCCTGAGACCCTAACTTGTG192760.10231102647587079No Hit
ACCCTGTAGAACCGAATTTGCG189290.10046925815323503No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AGTATGC50.00267249831750.208323
CGTATGC16700.01703.04723
CAACCCG11950.01479.255523
TAACTAA1650.01431.988523
AATAACC4050.01253.235523
CGTATTC151.3722149E-51166.805523
TAACTGC3350.01149.390523
GATTCCT5300.0957.661123
GCGCCAC50.009226477941.865822
ATAACTA18600.0891.227822
TCGTATG17650.0885.834122
ACGCATA203.251266E-5875.104123
ACAACCC24850.0854.6910422
TCTGACT35950.0666.9778423
TAATAAC5300.0657.5289322
ATAAAAA1250.0602.7940722
GACAACC38900.0587.789521
ACCGTAA301.096363E-4583.402823
ATAACCA301.096363E-4583.402823
GATAACA3500.0580.4939621