FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_7_JG55_1_ACTTGA_L002_R1_001_TRIMMED_prinseq_good_tzcy.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_7_JG55_1_ACTTGA_L002_R1_001_TRIMMED_prinseq_good_tzcy.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18588937
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG16825029.051093131360874No Hit
AACATTCAACGCTGTCGGTGAGT13685897.362384411760608No Hit
TTCAAGTAATCCAGGATAGGCT9346975.028243411659311No Hit
TCACAGTGAACCGGTCTCTTT8889514.782150802921114No Hit
AACATTCAACGCTGTCGGTGA4043402.1751647229747455No Hit
TGAGGTAGTAGGTTGTATAGTT3145231.6919902412924417No Hit
TAAAGCTAGAGAACCGAAAGTA2115801.1382038682470115No Hit
TTAAAGGGAATTTGCGACTGTT2048751.1021340273518598No Hit
CCTGTCTGAGGGTCGCT2023531.0885668179950256No Hit
TCCCTGAGACCCTTAACCTGTG1952731.0504796481907492No Hit
AGCTACATCTGGCTACTGGGTCTC1882911.0129196736747237No Hit
TAGCTTATCAGACTGGTGTTGGC1701440.9152970931043556No Hit
TCCCTGAGACCCTTAACCTGTGA1697070.9129462324822554No Hit
TCTTTGGTTATCTAGCTGTATGA1552550.8352010660964637No Hit
AACATTCATTGCTGTCGGTGGG1547950.8327264759679373No Hit
TCACAGTGAACCGGTCTCTTTT1502300.8081688587141912No Hit
TCACAGTGAACCGGTCTCTT1473750.7928102612860541No Hit
TTGCATAGTCACAAAAGTGATC1398190.7521624286531285No Hit
TCTTTGGTTATCTAGCTGTAT1377440.7409998753559711No Hit
AACATTCATTGCTGTCGGTGGGT1358770.7309562671604084No Hit
AAGCTGCCAGCTGAAGAACTGT1236000.6649116084475406No Hit
TTCACAGTGGCTAAGTTCTGC1095560.5893612959148766No Hit
TTCCCTTTGTCATCCTATGCCTG994260.5348665176497183No Hit
TCTTTGGTTATCTAGCTGTATG965710.5195079202215813No Hit
CTGTCTGAGGGTCGCT929200.499867205962342No Hit
AGCTGGTGTTGTGAATCAGGCCG893330.48057078250359336No Hit
AACCCGTAGATCCGAACTTGTG892920.48035022120952914No Hit
TGAGGTAGTAGTTTGTATAGTT871910.46904779977467237No Hit
TTCACAGTGGCTAAGTTCTG863200.4643622171617452No Hit
TGAGGTAGTAGTTTGTGCTGTT855750.4603544570622839No Hit
TATTGCACTCGTCCCGGCCTCC853210.4589880529478367No Hit
TAACAGTCTACAGTCATGGCT828590.4457436162164625No Hit
TAAAGCTAGAGAACCGAAAGT810380.43594746703375237No Hit
TCCCTGAGACCCTAACTTGTGA792700.42643643367019857No Hit
ACCTTGGCTTTAGACTGCTTACT775150.4169953343754944No Hit
CTACGCCTGTCTGAGGGTCGCT772350.4154890621233479No Hit
TAAAGGGAATTTGCGACTGTT759830.4087538733387498No Hit
AGCTACATCTGGCTACTGGGTCT754000.4056175993280304No Hit
TCCAGCATCAGTGATTTTGTTG711660.3828406110580718No Hit
TATTGCACTTGTCCCGGCCTGT699070.3760677654671701No Hit
AAGCTGCCAGCTGAAGAACT673210.3621562653098453No Hit
CCCTGAGACCCTTAACCTGTGA625400.33643666660444327No Hit
TACCCTGTAGAACCGAATTTGT624680.3360493394538913No Hit
TCCCTGAGACCCTTAACCTGT584990.3146979302797142No Hit
TGTCTGAGGGTCGCT575590.309641159147508No Hit
AACATTCAACGCTGTCGGTGG539180.2900542403258454No Hit
TGAGGTAGTTGGTTGTATAGTT508640.2736251136899329No Hit
AACTCCAGTCACACTTGAATCT508040.27330234106447293Illumina PCR Primer Index 8 (100% over 22bp)
CCACGTTCCCGTGG503090.2706394669044282No Hit
TACCCTGTAGAACCGAATGTGT492830.26512005500906266No Hit
TAAATCTAGAGAACCGAAAGTA486950.2619568832795549No Hit
TCTTTGGTTATCTAGCTGTATGT486830.2618923287544629No Hit
TACCCTGTAGATCCGGATTTGT479720.2580674731427623No Hit
TGATGTAGTAGGTTGTATAGTT456780.24572679976267606No Hit
TAGCAGCACGTAAATATTGGAG456710.24568914295637237No Hit
TCCAGCATCAGTGATTTTGTT456030.24532333398085107No Hit
CCTTTCTGAGGGTCGCT432320.23256843573142455No Hit
TGTAAACATCCTTGACTGGAAGCT425540.2289211050637269No Hit
AGCTACATTGTCTGCTGGGTTT409540.220313835051461No Hit
TTCAAGTAATCCAGGATAGGC407160.21903350363713645No Hit
TTCAAGTAATCCAGGATAGGTT405590.21818891526718284No Hit
AACAGTCAACGCTGTCGGTGAG400940.21568742741986807No Hit
AGAATAATGCCAGCAGTCGGTC395340.21267488291557501No Hit
TGAGGTAGTAGGTTGTATAGT391100.21039395636232452No Hit
TGCTCAGTAGTCAGTGTAGATCC375430.20196421129406164No Hit
TTGCATAGTCACAAAAATGAGC373810.20109272520531968No Hit
TAGCTTATCAGACTGGTGTTGG359790.1935506048570717No Hit
AGCTACATTGTCTGCTGGGTTTC355940.19147948051037023No Hit
ACCATCGACCGTTGACTGTACC351250.18895647448802477No Hit
AAGCTGCCAGTTGAAGAGCTGT351170.18891343813796344No Hit
AACATTCATTGCTGTCGGTGGGTT341870.1839104624433339No Hit
AATATTCAACGCTGTCGGTGAG336450.18099474972667884No Hit
ATCTACATCTGGCTACTGGGTCTC335160.18030078858193987No Hit
TGTAAACATCCTACACTCTCAGCT334160.17976283420617328No Hit
TTCAAGTAATCCAGGATAGGCTT333920.17963372515598927No Hit
ACCATCGACCGTTGACTGTGCC327670.17627151030744792No Hit
AACTCCAGTCACACTTGAATCTCG326630.17571203775665062Illumina PCR Primer Index 8 (100% over 24bp)
AACATTCAACGCTGTCGGTGAGTT324950.1748082744053627No Hit
TACCCTGTAGAACCGAATTTGCG324350.17448550177990274No Hit
AACAGTCAACGCTGTCGGTGAGT323990.17429183820462676No Hit
AAGGTCCAACCTCACATGTCCT319560.17190870031998065No Hit
AACTCCAGTCACACTTGAATCTCGTATGC310410.16698641778171608Illumina PCR Primer Index 8 (100% over 29bp)
ACCGTGGCTTTAGATTGTTACT302020.16247298056903417No Hit
AGCAGCATTGTACAGGGCTATGA297610.16010060177190336No Hit
TCCCTGAGACCCTTAACCTGTGG297140.15984776321529306No Hit
TGCTCAGTAGTCAGTGTAGATC291560.15684597779851533No Hit
TGAGATGAAGCACTGTAGCTC286210.1539679218881639No Hit
TTCCCTTTGTCATCCTATGCCT279570.15039590483307358No Hit
AATATTCAACGCTGTCGGTGAGT277650.14936303243160168No Hit
TACCCTGTAGAACCGAATTTGC270920.1457425994826923No Hit
AACATTCAACGCTGTCGGTGAGA269320.14488187248146572No Hit
AACATTCAACGCTGTCGGTG264530.14230507102154363No Hit
CTTTGGTTATCTAGCTGTATGA261170.14049754431896777No Hit
TACCCTGTAGATCCGGATTTGTG255280.1373289930457024No Hit
AGCTACATCTGGCTACTGGGTCTCT241250.12978149315369675No Hit
TAACAGTCTACAGCCATGGTCG238900.12851730037064518No Hit
TGAGGTAGTTGGTTGTATTGTT238300.12819452774518522No Hit
AACTCCAGTCACACTTGAATCTC230940.12423518353954291Illumina PCR Primer Index 8 (100% over 23bp)
AAGCTGCCAGCTGAAGAACTGC224760.12091062549730519No Hit
CATTATTACTTTTGGTACGCG222270.11957111910164632No Hit
TCCCTGAGACCCTAACTTGTG221600.11921068966988269No Hit
CAGGCTGGTTAGATGGTTGTCT220360.11854362624393207No Hit
AAGCCCTTACCCCAAAAAGCAT213860.11504692280144907No Hit
TCACAGTGAACCGGTCTCT208840.11234639183510062No Hit
TGAGATGAAGCACTGTAGCTCT208550.1121903850661283No Hit
ACCACGTTCCCGTGG206720.11120592855847541No Hit
AACATTCATTGCTGTCGCTGGGT206360.11101226498319942No Hit
CACCACGTTCCCGTGG202660.10902183379286293No Hit
TTTAAGTAATCCAGGATAGGCT196560.10574031210068655No Hit
TGAGGTAGTAGGTTGTATAGTTT188870.10160344295104126No Hit
GAAGGATCATTA188440.10137212256946163No Hit
TAAATGGAATTTGCGACTGTT186740.10045760013065837No Hit
CCTTGGCTTTAGACTGCTTACT186350.10024779792410937No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACTGC50.00145286942373.73723
CGTATGC32450.02329.846723
TAACTAA1250.02183.838123
CAACCCG4200.02062.890423
AATAACC2700.01846.239923
GTATGCC600.01582.491323
TCGTATG33500.01306.442422
ATAACTA18250.01296.683122
TAACTGC2000.01246.21223
ACAACCC10450.01235.20522
GATTCCT3100.01225.154723
CATGCCG100.0058098471186.868523
GCGCGTT100.0058098471186.868523
ACCGCGG100.0058098471186.868523
TAATAAC4050.01112.176822
GCAAGCC50.0095745865924.579221
GTCTCGA102.7581387E-5924.579221
TCTGACT34050.0895.815623
CGTATAC408.762072E-8890.1513723
CGTATCC552.8921932E-10863.177123