FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_7_JG64_1_GATCAG_L007_R1_001_TRIMMED_prinseq_good_WyQi.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_7_JG64_1_GATCAG_L007_R1_001_TRIMMED_prinseq_good_WyQi.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13093979
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG12272309.372475700472714No Hit
AACATTCAACGCTGTCGGTGAGT10335887.8936127818747845No Hit
TTCAAGTAATCCAGGATAGGCT6498474.962945182667545No Hit
TCACAGTGAACCGGTCTCTTT5736984.381387811909581No Hit
AACATTCAACGCTGTCGGTGA3085112.3561287214528144No Hit
TGAGGTAGTAGGTTGTATAGTT2316011.768759519165259No Hit
CCTGTCTGAGGGTCGCT1753121.3388749134239486No Hit
TCCCTGAGACCCTTAACCTGTG1450231.1075548540287103No Hit
TTAAAGGGAATTTGCGACTGTT1445181.1036981195708349No Hit
TAGCTTATCAGACTGGTGTTGGC1434831.095793723206674No Hit
AGCTACATCTGGCTACTGGGTCTC1424191.0876678510023576No Hit
TAAAGCTAGAGAACCGAAAGTA1371821.047672369109497No Hit
TCCCTGAGACCCTTAACCTGTGA1280030.9775714471513968No Hit
AACATTCATTGCTGTCGGTGGG1148370.8770214157209202No Hit
TCTTTGGTTATCTAGCTGTATGA1135410.8671237367953623No Hit
AACATTCATTGCTGTCGGTGGGT1047390.7999020007592802No Hit
TTGCATAGTCACAAAAGTGATC1046410.7991535651615143No Hit
AAGCTGCCAGCTGAAGAACTGT1009580.7710261334617995No Hit
TCACAGTGAACCGGTCTCTTTT963470.7358114748771172No Hit
TCACAGTGAACCGGTCTCTT937440.7159321089487007No Hit
TCTTTGGTTATCTAGCTGTAT899820.6872013465120114No Hit
TTCCCTTTGTCATCCTATGCCTG846250.6462894128667841No Hit
TTCACAGTGGCTAAGTTCTGC779460.5952812357496525No Hit
TGAGGTAGTAGTTTGTGCTGTT767300.5859945246590055No Hit
TATTGCACTCGTCCCGGCCTCC746460.5700788125595742No Hit
AGCTGGTGTTGTGAATCAGGCCG703250.5370789123764441No Hit
TCTTTGGTTATCTAGCTGTATG684520.5227746279415906No Hit
TAACAGTCTACAGTCATGGCT652560.49836646293689646No Hit
ACCTTGGCTTTAGACTGCTTACT651890.49785477737515843No Hit
TTCACAGTGGCTAAGTTCTG623160.47591339500391744No Hit
TGAGGTAGTAGTTTGTATAGTT616950.4711707571854209No Hit
CTGTCTGAGGGTCGCT609760.4656796837691583No Hit
AACCCGTAGATCCGAACTTGTG602200.45990603772924943No Hit
TAAAGGGAATTTGCGACTGTT600750.45879865852847324No Hit
TCCAGCATCAGTGATTTTGTTG576110.43998084921321473No Hit
TAAAGCTAGAGAACCGAAAGT569030.4345737838742524No Hit
CTACGCCTGTCTGAGGGTCGCT525710.40148987561382216No Hit
TATTGCACTTGTCCCGGCCTGT519310.3966021329345343No Hit
AGCTACATCTGGCTACTGGGTCT516960.3948074149194832No Hit
TCCCTGAGACCCTAACTTGTGA512930.39172966445111906No Hit
CCCTGAGACCCTTAACCTGTGA496370.37908263026846156No Hit
AAGCTGCCAGCTGAAGAACT496210.3789604367014794No Hit
TCCCTGAGACCCTTAACCTGT414640.3166646288343673No Hit
TGTCTGAGGGTCGCT413030.31543505606660893No Hit
TGAGGTAGTTGGTTGTATAGTT400670.3059956030172341No Hit
AACATTCAACGCTGTCGGTGG397140.30329970744568935No Hit
TCCAGCATCAGTGATTTTGTT381170.2911032620412787No Hit
TGTAAACATCCTTGACTGGAAGCT378260.2888808665417899No Hit
CCACGTTCCCGTGG362040.2764934936889696No Hit
TCTTTGGTTATCTAGCTGTATGT361640.2761880097715141No Hit
TAGCAGCACGTAAATATTGGAG332370.25383422411170814No Hit
TGCTCAGTAGTCAGTGTAGATCC313090.23910989929035323No Hit
AGAATAATGCCAGCAGTCGGTC306540.23410760014201948No Hit
ACCATCGACCGTTGACTGTGCC294410.22484380034518153No Hit
ACCGTGGCTTTAGATTGTTACT293920.2244695825462986No Hit
ACCATCGACCGTTGACTGTACC290590.22192642893348155No Hit
TGAGATGAAGCACTGTAGCTC290100.2215522111345986No Hit
CCTTTCTGAGGGTCGCT289650.22120854172746116No Hit
TGAGGTAGTAGGTTGTATAGT288270.2201546222122397No Hit
TTCAAGTAATCCAGGATAGGC279880.21374709704361067No Hit
AACATTCATTGCTGTCGGTGGGTT276620.21125740311634836No Hit
AACTCCAGTCACGATCAGATCT274410.20956960447240675Illumina PCR Primer Index 9 (100% over 22bp)
TTGCATAGTCACAAAAATGAGC274320.20950087059097927No Hit
AGCTACATTGTCTGCTGGGTTT273860.20914956408590543No Hit
TTCAAGTAATCCAGGATAGGTT264740.20218453076792012No Hit
AAGGTCCAACCTCACATGTCCT263580.20129862740729917No Hit
AGCTACATTGTCTGCTGGGTTTC262810.20071057086619737No Hit
TGTAAACATCCTACACTCTCAGCT262030.20011487722715912No Hit
TAGCTTATCAGACTGGTGTTGG261450.19967192554684868No Hit
TACCCTGTAGAACCGAATGTGT260010.19857218344400887No Hit
AAGCTGCCAGTTGAAGAGCTGT256390.19580755399103666No Hit
ATCTACATCTGGCTACTGGGTCTC247840.1892778352554254No Hit
AACATTCAACGCTGTCGGTGAGTT245850.18775805276608432No Hit
AGCAGCATTGTACAGGGCTATGA238800.1823738987209312No Hit
TTCAAGTAATCCAGGATAGGCTT233660.17844843038162808No Hit
TGCTCAGTAGTCAGTGTAGATC231390.17671480915006815No Hit
TGAGATGAAGCACTGTAGCTCT223530.17071205017206764No Hit
TCCCTGAGACCCTTAACCTGTGG219900.167939783621159No Hit
TAACAGTCTACAGCCATGGTCG219460.16760375131195795No Hit
AACATTCAACGCTGTCGGTGAGA204730.15635430605165931No Hit
TTCCCTTTGTCATCCTATGCCT200780.1533376523667863No Hit
CATTATTACTTTTGGTACGCG198340.15147420047030777No Hit
AATATTCAACGCTGTCGGTGAG198110.15129854721777086No Hit
AACATTCAACGCTGTCGGTG197650.15094724071269702No Hit
CCTTGGCTTTAGACTGCTTACT195040.14895395815129991No Hit
AACAGTCAACGCTGTCGGTGAG194880.1488317645843177No Hit
CACCACGTTCCCGTGG194370.14844227258956197No Hit
AACTCCAGTCACGATCAGATCTCG193810.14801459510512427Illumina PCR Primer Index 9 (100% over 24bp)
CTTTGGTTATCTAGCTGTATGA189190.1444862558585133No Hit
AGCTACATCTGGCTACTGGGTCTCT187770.14340178795154626No Hit
TGAGGTAGTTGGTTGTATTGTT186840.14269153784346225No Hit
TAAATCTAGAGAACCGAAAGTA183130.13985817450906252No Hit
CAGGCTGGTTAGATGGTTGTCT179720.13725392411275442No Hit
AAGCTGCCAGCTGAAGAACTGC172240.13154137485633663No Hit
TGATGTAGTAGGTTGTATAGTT170790.13043399565556046No Hit
TGTAAACATCCCCGACTGGAAGCT169540.12947935841351205No Hit
AATATTCAACGCTGTCGGTGAGT167990.128295608233372No Hit
AAGCCCTTACCCCAAAAAGCAT165430.12634051116165682No Hit
AACAGTCAACGCTGTCGGTGAGT165080.12607321273388328No Hit
CTTTTTGCGGTCTGGGCTTGC161570.12339259135821128No Hit
TATGGCTTTTTATTCCTATCTG156150.1192532842766893No Hit
AACTCCAGTCACGATCAGATCTCGTATGC153360.11712253395243723Illumina PCR Primer Index 9 (100% over 29bp)
ACCATTGACCGTTGACTGTACC152160.11620608220007074No Hit
TAAGGCACGCGGTGAATGCC151620.1157936789115058No Hit
TTATGTAGTAGGTTGTATAGTT150640.11504524331373985No Hit
TCCCTGAGACCCTAACTTGTG148800.11364001729344457No Hit
AACATTCATTGCTGTCGCTGGGT143170.10934033115525847No Hit
ACCACGTTCCCGTGG142050.10848497618638306No Hit
TGAGGTAGTAGATTGAATAGTT141760.10826350034622784No Hit
TCACAGTGAACCGGTCTCT138630.10587308869213859No Hit
AACTCCAGTCACGATCAGATCTC138000.10539195152214619Illumina PCR Primer Index 9 (100% over 23bp)
TGAGGTAGTAGGTTGTATAGTTT137960.10536140313040063No Hit
TGAGGTAGTAGGTTGTGTGGTT136500.10424638683168806No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC18500.02276.877723
TAACTGC2350.02111.636223
CAACCCG2000.02019.55923
TAACTAA1500.01846.454123
GATTCCT5300.01676.615223
AATAACC2500.01615.647223
GTATGCC251.4959369E-81384.840523
CCACAAT50.0052634021247.039222
ACGCATT50.0052634021247.039222
ATATGGC50.0052634021247.039222
TCGTATG19550.01208.76722
ACAACCC6100.01195.93122
ATAACTA16900.01191.697322
TTGATTC100.00614411851154.033823
CATATTG201.41713535E-51154.033823
CGTATTC201.41713535E-51154.033823
TATGGCG100.00614411851154.033823
GCCGACC100.00614411851154.033823
CTTATGC100.00614411851154.033823
GAGCGAT100.00614411851154.033823