FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_grz_7_JG65_1_TAGCTT_L008_R1_001_TRIMMED_prinseq_good_A8hM.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_grz_7_JG65_1_TAGCTT_L008_R1_001_TRIMMED_prinseq_good_A8hM.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14944024
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG157603810.54627588927855No Hit
AACATTCAACGCTGTCGGTGAGT12765798.542404642819095No Hit
TTCAAGTAATCCAGGATAGGCT7624585.102092983790711No Hit
TCACAGTGAACCGGTCTCTTT6193844.1446935577726585No Hit
AACATTCAACGCTGTCGGTGA3831962.5642089439899185No Hit
TGAGGTAGTAGGTTGTATAGTT2611941.7478157154993863No Hit
TCCCTGAGACCCTTAACCTGTG1784501.194122814577921No Hit
TTAAAGGGAATTTGCGACTGTT1724541.153999752677057No Hit
CCTGTCTGAGGGTCGCT1596101.0680523532349788No Hit
TAAAGCTAGAGAACCGAAAGTA1549201.0366685706607537No Hit
AACATTCATTGCTGTCGGTGGG1532891.0257545089595679No Hit
TCCCTGAGACCCTTAACCTGTGA1479030.9897133462847757No Hit
AACATTCATTGCTGTCGGTGGGT1359670.9098419542152769No Hit
TAGCTTATCAGACTGGTGTTGGC1288290.8620770416321601No Hit
TCTTTGGTTATCTAGCTGTATGA1118850.7486939260804185No Hit
AGCTACATCTGGCTACTGGGTCTC1048020.7012970535914557No Hit
TCACAGTGAACCGGTCTCTTTT1044150.6987073896562265No Hit
AAGCTGCCAGCTGAAGAACTGT1032070.690623890860989No Hit
TCACAGTGAACCGGTCTCTT975930.6530570347049764No Hit
TTGCATAGTCACAAAAGTGATC916720.6134358456597768No Hit
TCTTTGGTTATCTAGCTGTAT911590.610003035327031No Hit
TGAGGTAGTAGTTTGTGCTGTT859790.5753403500957974No Hit
TTCCCTTTGTCATCCTATGCCTG836680.559875974503253No Hit
TTCACAGTGGCTAAGTTCTGC815640.5457967679923426No Hit
TAACAGTCTACAGTCATGGCT772980.5172502399621414No Hit
TCTTTGGTTATCTAGCTGTATG716030.47914136112201106No Hit
ACCTTGGCTTTAGACTGCTTACT708660.47420962386034715No Hit
TGAGGTAGTAGTTTGTATAGTT682170.4564834745982742No Hit
TCCCTGAGACCCTAACTTGTGA664780.44484671598493153No Hit
TATTGCACTCGTCCCGGCCTCC656490.439299348020319No Hit
AGCTGGTGTTGTGAATCAGGCCG646820.43282853400128374No Hit
AACCCGTAGATCCGAACTTGTG633910.4241896292457774No Hit
TAAAGCTAGAGAACCGAAAGT626750.41939841638369957No Hit
TAAAGGGAATTTGCGACTGTT625990.41888985188995953No Hit
CTGTCTGAGGGTCGCT618700.4140116477328998No Hit
TCCAGCATCAGTGATTTTGTTG580490.3884428986463084No Hit
TTCACAGTGGCTAAGTTCTG567440.3797103109577447No Hit
CCCTGAGACCCTTAACCTGTGA558610.37380159453705375No Hit
AAGCTGCCAGCTGAAGAACT513420.34356208207374395No Hit
CTACGCCTGTCTGAGGGTCGCT497970.33322350124705363No Hit
TCCCTGAGACCCTTAACCTGT490530.32824492251886106No Hit
AACATTCAACGCTGTCGGTGG482780.3230589030103271No Hit
AGCTACATCTGGCTACTGGGTCT444190.2972358716768656No Hit
TATTGCACTTGTCCCGGCCTGT441120.2951815387876786No Hit
AACTCCAGTCACTAGCTTATCT429240.2872318727539517Illumina PCR Primer Index 10 (100% over 22bp)
TGAGGTAGTTGGTTGTATAGTT415940.27833199411349985No Hit
TGTCTGAGGGTCGCT397670.26610637134951065No Hit
CCACGTTCCCGTGG392300.2625129617029523No Hit
TAGCAGCACGTAAATATTGGAG391660.2620846968661185No Hit
AACTCCAGTCACTAGCTTATCTCGTATGC384510.2573001756421162Illumina PCR Primer Index 10 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGT384100.2570258184810196No Hit
TAAATCTAGAGAACCGAAAGTA378980.2535996997863494No Hit
TCCAGCATCAGTGATTTTGTT375870.25151860034486023No Hit
AACATTCATTGCTGTCGGTGGGTT344790.2307209892061201No Hit
TGTAAACATCCTTGACTGGAAGCT336360.22507993830845024No Hit
ACCATCGACCGTTGACTGTACC332630.22258395730627842No Hit
AACTCCAGTCACTAGCTTATCTCG332520.2225103492874476Illumina PCR Primer Index 10 (100% over 24bp)
TGAGGTAGTAGGTTGTATAGT327720.2192983630111943No Hit
TTCAAGTAATCCAGGATAGGC324220.2169562896847596No Hit
TTCAAGTAATCCAGGATAGGTT311880.2086988082995584No Hit
AACATTCAACGCTGTCGGTGAGTT301130.20150529736836614No Hit
ACCATCGACCGTTGACTGTGCC300110.2008227502846623No Hit
TAGCTTATCAGACTGGTGTTGG298160.19951788085993438No Hit
AGAATAATGCCAGCAGTCGGTC297630.1991632240419314No Hit
AAGCTGCCAGTTGAAGAGCTGT297100.19880856722392842No Hit
TACCCTGTAGAACCGAATGTGT293820.19661370993515537No Hit
AACAGTCAACGCTGTCGGTGAG290810.1945995268744215No Hit
AAGGTCCAACCTCACATGTCCT287620.19246489432832817No Hit
TTGCATAGTCACAAAAATGAGC281870.18861720243489974No Hit
TTCAAGTAATCCAGGATAGGCTT275670.18446838682807254No Hit
TGTAAACATCCTACACTCTCAGCT265860.17790388987597985No Hit
AACATTCAACGCTGTCGGTGAGA259480.17363462478379318No Hit
ACCGTGGCTTTAGATTGTTACT256820.1718546490557028No Hit
TGAGATGAAGCACTGTAGCTC253080.16935197641545544No Hit
TCCCTGAGACCCTTAACCTGTGG251730.1684486052752592No Hit
TTCCCTTTGTCATCCTATGCCT246930.1652366189990059No Hit
TAACAGTCTACAGCCATGGTCG241460.16157629297169224No Hit
AACATTCAACGCTGTCGGTG240140.16069299674572257No Hit
CCTTTCTGAGGGTCGCT239490.16025804027081325No Hit
ATCTACATCTGGCTACTGGGTCTC238710.1597360925009221No Hit
AGCTACATTGTCTGCTGGGTTT237600.15899332067453853No Hit
AGCAGCATTGTACAGGGCTATGA234100.15665124734810384No Hit
AACAGTCAACGCTGTCGGTGAGT232760.1557545678459831No Hit
TGAGATGAAGCACTGTAGCTCT224310.1501001336721622No Hit
AATATTCAACGCTGTCGGTGAG222110.14862797329554608No Hit
AGCTACATTGTCTGCTGGGTTTC217820.1457572605611447No Hit
TGCTCAGTAGTCAGTGTAGATCC214210.1433415792158792No Hit
AACTCCAGTCACTAGCTTATCTC208790.13971471137894317Illumina PCR Primer Index 10 (100% over 23bp)
CACCACGTTCCCGTGG201490.13482981558380797No Hit
CATTATTACTTTTGGTACGCG199940.13379261168210116No Hit
CTTTGGTTATCTAGCTGTATGA198990.13315690606492603No Hit
AAGCCCTTACCCCAAAAAGCAT191820.12835900156477265No Hit
TGAGGTAGTTGGTTGTATTGTT190000.1271411234350266No Hit
TAAGGCACGCGGTGAATGCC188900.12640504324671856No Hit
TGATGTAGTAGGTTGTATAGTT184630.12354771378846822No Hit
AATATTCAACGCTGTCGGTGAGT182140.12188149590766181No Hit
TCCCTGAGACCCTAACTTGTG180950.12108519097667403No Hit
ACCATTGACCGTTGACTGTACC176470.11808733711883761No Hit
AAGCTGCCAGCTGAAGAACTGC175800.11763899736777725No Hit
TGAGTTAGTAGGTTGTATAGTT175460.11741148167320929No Hit
CAGGCTGGTTAGATGGTTGTCT174200.11656833527569281No Hit
CTTTTTGCGGTCTGGGCTTGC169590.11348349012287454No Hit
CCTTGGCTTTAGACTGCTTACT167940.11237936984041245No Hit
TGCTCAGTAGTCAGTGTAGATC167100.11181727224206814No Hit
ACCACGTTCCCGTGG165780.11093397601609847No Hit
TAAGGCACGCGGTGAATGCCA159400.10666471092391179No Hit
TAATCTCTGCAGGCAACTGTGA158830.10628328755360672No Hit
TGAGGTAGTAGGTTGTATAGTTT158430.10601562203058561No Hit
TGAGGTAGTAGATTGAATAGTT157480.10537991641341048No Hit
TGTAAACATCCCCGACTGGAAGCT156110.10446316199706318No Hit
TAAATCTAGAGAACCGAAAGT155580.1041085051790602No Hit
AACATTCATTGCTGTCGCTGGGT155490.10404828043638047No Hit
TAAATGGAATTTGCGACTGTT154800.10358655740916904No Hit
TTAGGTAGTAGGTTGTATAGTT154280.1032385922292416No Hit
GAAGGATCATTA151520.10139170012039594No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CACCTTA50.00299636881652.851123
CCCGTTA50.00299636881652.851123
CGTATGC39100.01640.169323
CAACCCG4250.01516.73423
AATAACC4050.01367.173123
TAACTAA1150.01365.398723
GATTCCT8000.01322.280923
TAACTGC2400.01308.507223
GTATGCC255.691072E-8991.7106323
TGCGTTG50.008917854958.0090322
TCGTATG40250.0942.5381522
ATAACTA17650.0928.156122
ACAACCC10900.0896.4856622
TAACACC203.8592552E-5826.4255423
TAATAAC5350.0787.895422
ATAAAAA1500.0734.473722
TCTGACT27150.0648.3559623
GGATTCC11650.0637.302222
GATAACA3650.0627.7341321
GACAACC18400.0624.4479421