FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_12_JM105_1_ACAGTG_L006_R1_001_TRIMMED_prinseq_good_Vy7z.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_12_JM105_1_ACAGTG_L006_R1_001_TRIMMED_prinseq_good_Vy7z.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5586081
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG4187347.496024493737201No Hit
TTCAAGTAATCCAGGATAGGCT2756224.934085273736632No Hit
AACATTCAACGCTGTCGGTGAGT2418234.3290278103736775No Hit
TCCCTGAGACCCTTAACCTGT1574192.8180579551209517No Hit
AACCCGTAGATCCGAACTTGTG1505272.69467986590241No Hit
TCACAGTGAACCGGTCTCTTT1472222.6355149522536463No Hit
TGAGGTAGTAGGTTGTATAGTT1141242.0430065371411548No Hit
TAAAGCTAGAGAACCGAAAGTA1078081.929939791420855No Hit
TCCCTGAGACCCTTAACCTGTG1072401.9197716610267554No Hit
AACTCCAGTCACACAGTGATCTCGTATGC992041.7759140979158734Illumina PCR Primer Index 5 (100% over 29bp)
AACATTCAACGCTGTCGGTGA707611.2667378077761493No Hit
TCCCTGAGACCCTTAACCTGTGA559191.0010416963162545No Hit
TATTGCACTCGTCCCGGCCTCC540040.9667600595122054No Hit
AGCTACATCTGGCTACTGGGTCTC512670.9177632762575408No Hit
AACTCCAGTCACACAGTGATCTCGTCTGC501930.8985369170264448Illumina PCR Primer Index 5 (96% over 29bp)
TAAAGCTAGAGAACCGAAAGT493590.8836069509196162No Hit
CCCTGAGACCCTTAACCTGTGA464620.8317459055821067No Hit
AACCCGTAGATCCGAACTTGT458020.8199308244903718No Hit
TCCCTGAGACCCTAACTTGTGA400700.7173186353724552No Hit
TCTTTGGTTATCTAGCTGTATGA375830.6727972616222356No Hit
TCCCTGAGACCCTAACTTGT362980.649793656769388No Hit
CCACGTTCCCGTGG361890.64784237822545No Hit
CCTGTCTGAGGGTCGCT358490.6417558212994047No Hit
AACATTCAAGGCTGTCGGTGAG341310.6110008071848582No Hit
TCTTTGGTTATCTAGCTGTAT332080.594477595294447No Hit
ACCTTGGCTTTAGACTGCTTACT290450.5199530762264277No Hit
TCACAGTGAACCGGTCTCTTTT289610.5184493386329343No Hit
TGAGGTAGTAGTTTGTATAGTT279360.5001001596647096No Hit
TTCACAGTGGCTAAGTTCTGC271870.4866918327893921No Hit
AAGCTGCCAGCTGAAGAACTGT265170.4746977353174793No Hit
TTAAAGGGAATTTGCGACTGTT262360.4696673750344831No Hit
AACATTCATTGCTGTCGGTGGG261770.468611178391434No Hit
TCCAGCATCAGTGATTTTGTT253770.4542898679772098No Hit
TCACAGTGAACCGGTCTCTT247300.44270750817970594No Hit
TTGCATAGTCACAAAAGTGATC241190.4317696073508422No Hit
TGAGGTAGTAGTTTGTGCTGTT237510.4251818045602991No Hit
AACCCGTAGATCCGAACTTGTGA234040.41896993616812933No Hit
TAGCTTATCAGACTGGTGTTGGC233280.417609411678778No Hit
TTCAAGTAAGCCAGGATAGGCT223940.4008892817701713No Hit
TCTTTGGTTATCTAGCTGTATG222760.3987768884840732No Hit
TGAGGTAGTAGGTTGTATAGT210450.3767399720841857No Hit
TAAAGCTAGAGAACCGAAAGTAA196770.35225053127586226No Hit
AACATTCAAGGCTGTCGGTGAGT195540.35004862979967527No Hit
TCCCTGAGACCCTTAACCTGTGT195440.3498696134194975No Hit
TACCCTGTAGAACCGAATTTGT185370.33184266393559275No Hit
TCCCTGAGACCCTAACTTGTG184860.33092968039668597No Hit
TATTGCACTTGTCCCGGCCTGT183950.329300631337068No Hit
TCCCTGAGACCCTTAACCTG183170.3279043035716811No Hit
AACATTCATTGCTGTCGGTGGGT181990.325791910285583No Hit
TGAGGTAGTTGGTTGTATAGTT178250.3190966976669332No Hit
AAGCTGCCAGCTGAAGAACT174400.3122045670300878No Hit
TAACAGTCTACAGTCATGGCT167960.30067591214663736No Hit
TTCACAGTGGCTAAGTTCTG159220.28502988051909733No Hit
AGCTGGTGTTGTGAATCAGGCCG138920.24868955534300344No Hit
TTCAAGTAATCCAGGATAGGC135700.24292522790127818No Hit
TCCAGCATCAGTGATTTTGTTG135690.2429073262632604No Hit
TACCCTGTAGATCCGGATTTGT134220.24027578547464673No Hit
AGCTACATCTGGCTACTGGGTCT133920.23973873633411333No Hit
TCCCTGAGAGCCTTAACCTGT121020.2166456232911768No Hit
TGAGATGAAGCACTGTAGCTC118410.21197329576853613No Hit
TAAAGGGAATTTGCGACTGTT117410.21018313196675809No Hit
AACCCGTAGGTCCGAACTTGTG117250.20989670575847363No Hit
AGCTACATTGTCTGCTGGGTTT117100.20962818118820692No Hit
TCACAGTGAGCCGGTCTCTTT108140.19358831352427577No Hit
AGAATAATGCCAGCAGTCGGTC106050.1898468711785597No Hit
ACCGTGGCTTTAGATTGTTACT104030.1862307402989681No Hit
AGCTACATTGTCTGCTGGGTTTC103770.18576529771050582No Hit
AACATTCAAAGCTGTCGGTGAG103650.18555047805429242No Hit
TGAGGTAGTGGGTTGTATAGTT103280.1848881174476346No Hit
TGAGATGAAGCACTGTAGCTCT102200.18295474054171432No Hit
TAAAGCTAGAGAACCGAAAGTAT101310.18136149475813185No Hit
TCTTTGGTTATCTAGCTGTATGT98720.17672497051152677No Hit
TGAGATGAAGCACTGTAGCT95760.1714260856582638No Hit
TACCCTGTAGAACCGAATTTGCG94610.16936739728621908No Hit
AAGCTGCCAGTTGAAGAGCTGT94210.1686513317655079No Hit
CTTTGGTTATCTAGCTGTATGA90610.16220674207910699No Hit
AACTCCATTCACACAGTGATCTCGTATGC89810.16077461103768456Illumina PCR Primer Index 5 (96% over 29bp)
ACCATCGACCGTTGACTGTGCC89080.1594677914623866No Hit
TGTAAACATCCTTGACTGGAAGCT88490.15841159481933756No Hit
TTCCCTTTGTCATCCTATGCCTG86670.15515349670010156No Hit
TCCCTGAGAGCCTTAACCTGTG85110.15236084116932783No Hit
CCTTGGCTTTAGACTGCTTACT84840.15187749694284777No Hit
CCCTGCGACCCTTAACCTGTGA83800.15001572658899862No Hit
CACCACGTTCCCGTGG83070.14870890701370068No Hit
TGTCTGAGGGTCGCT82990.14856569390955843No Hit
TAAAGCTAGGGAACCGAAAGTA82670.14799284149298944No Hit
TTCCCTTTGTCATCCTATGCCT80360.1438575631108822No Hit
TGAGGTAGTTGGTTGTATTGTT80310.1437680549207933No Hit
CTGTCTGAGGGTCGCT79700.1426760550017087No Hit
AACCCGTAGATCCGAACTTG79670.14262235008765536No Hit
TGAGGTAGTAGGTTGTGTGGTT77750.13918523558824156No Hit
TGAGGTAGTAGGTTGTATAGTTT77700.13909572739815268No Hit
TACGACCTCAGATCAGACGAGA77390.13854077661960149No Hit
TACCCTGTAGAACCGAATGTGT74980.13422648185731642No Hit
AACTCCATTCACACAGTGATCTCGTCTGC74510.13338510487048075Illumina PCR Primer Index 5 (96% over 25bp)
ACCATCGACCGTTGACTGTACC73400.13139802305050713No Hit
AACATTCAACGCTGTCGGTGAGA72560.1298942854570136No Hit
TACCCTGTAGAACCGAATTTGC70160.12559789233274635No Hit
TAACAGTCTACAGCCATGGTCG69310.12407625310123503No Hit
TGTAAACATCCTACACTCTCAGCT67900.12155212214072798No Hit
ACCTTGGCTCTAGACTGCTTACT66450.11895638462814986No Hit
TAGCTTATCAGACTGGTGTTGG66030.1182045158314031No Hit
TCCCTGAGACCCTTAACCTGTGG65570.1173810404825852No Hit
TGCTCAGTAGTCAGTGTAGATCC64970.11630694220151837No Hit
TTCAAGTAAACCAGGATAGGCT63850.11430195874352699No Hit
TTCAAGTAATCCAGGATAGGTT63580.11381861451704692No Hit
TAACGGAACCCATAATGCAGCTG61660.11038150001763311No Hit
TACCCTGTAGATCCGGATTTGTG60690.10864504112990843No Hit
AGCAGCATTGTACAGGGCTATGA60430.10817959854144614No Hit
CTGGACAACTCTTAGCGG60060.10751723793478826No Hit
TTCAAGTAATCCAGGATAGGCTT59850.10714130353641489No Hit
AACATTCAACGCTGTCGGTGG59510.10653264784381035No Hit
AACATTCAAAGCTGTCGGTGAGT58600.10490359878419235No Hit
TAAGGCACGCGGTGAATGCC56900.1018603203211697No Hit
AACATTCAAGGCTGTCGGTGA56700.10150228756081411No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATTCCG259.822543E-11391.1644323
GGTATGC103.6334989E-4391.1644323
TAACTAA300.0391.1644323
CGTCTGC68250.0385.7196723
CGTATGC130400.0385.6149623
CGGATGC1700.0368.1547523
TAACTGC500.0352.0479723
ATCACTA1800.0349.00322
AAAACAC105.113826E-4349.00322
ATCAACA105.113826E-4349.00322
TACTAAC251.9463187E-10349.00322
ATAAAAA202.669185E-8349.00322
TAGTATG105.113826E-4349.00322
TCGTCTG68450.0343.649422
TCGTATG131550.0341.7072422
ATAACTA4950.0327.8512622
ATGCCGT302.910383E-10325.9703723
GATACCA350.0320.0631421
GATAACA1900.0320.0631421
GATCACA700.0320.0631421