FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_12_JM107_1_GCCAAT_L007_R1_001_TRIMMED_prinseq_good_PdwZ.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_12_JM107_1_GCCAAT_L007_R1_001_TRIMMED_prinseq_good_PdwZ.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5467109
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG4178937.643765653840083No Hit
TTCAAGTAATCCAGGATAGGCT2420614.427586865379856No Hit
AACATTCAACGCTGTCGGTGAGT2339924.279995149172991No Hit
TCCCTGAGACCCTTAACCTGT1793703.280893064323393No Hit
AACCCGTAGATCCGAACTTGTG1751283.2033017816180362No Hit
TCACAGTGAACCGGTCTCTTT1391702.545586707709687No Hit
CCACGTTCCCGTGG1323182.420255385433142No Hit
TGAGGTAGTAGGTTGTATAGTT1310772.3975560026332015No Hit
TCCCTGAGACCCTTAACCTGTG1158322.1187066144099194No Hit
AACTCCAGTCACGCCAATATCTCGTATGC1043921.9094552532243274Illumina PCR Primer Index 6 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTA1041121.9043337164120928No Hit
AACATTCAACGCTGTCGGTGA724001.3242830900207039No Hit
AGCTACATCTGGCTACTGGGTCTC707411.2939379844082128No Hit
TATTGCACTCGTCCCGGCCTCC659501.2063048313102958No Hit
TAAAGCTAGAGAACCGAAAGT527470.9648060794105258No Hit
AACCCGTAGATCCGAACTTGT500300.9151088811289476No Hit
CCTGTCTGAGGGTCGCT499840.9142674857955091No Hit
TCCCTGAGACCCTTAACCTGTGA493270.9022501654896582No Hit
TCTTTGGTTATCTAGCTGTATGA406910.7442873372380173No Hit
TGAGGTAGTAGTTTGTATAGTT336640.6157550544538256No Hit
TCCCTGAGACCCTAACTTGTGA336360.6152429007726021No Hit
TGAGGTAGTAGTTTGTGCTGTT331660.606646035409208No Hit
TCCCTGAGACCCTAACTTGT331170.6057497664670669No Hit
TCTTTGGTTATCTAGCTGTAT322090.5891413542331057No Hit
TTAAAGGGAATTTGCGACTGTT314880.5759533969416011No Hit
CCCTGAGACCCTTAACCTGTGA304620.5571866227653409No Hit
AACATTCATTGCTGTCGGTGGG293880.5375418708498404No Hit
TAGCTTATCAGACTGGTGTTGGC285310.5218663099638218No Hit
AACTCCAGTCACGCCCATATCTCGTATGC271560.49671590597516896Illumina PCR Primer Index 6 (96% over 29bp)
ACCTTGGCTTTAGACTGCTTACT264590.48396693755328457No Hit
TCACAGTGAACCGGTCTCTT257240.4705229034211683No Hit
AAGCTGCCAGCTGAAGAACTGT256750.4696266344790272No Hit
TCACAGTGAACCGGTCTCTTTT254280.46510870736252014No Hit
AACTCCAGTCACGCCAATATCTCGTCTGC250700.4585604567240199Illumina PCR Primer Index 6 (96% over 29bp)
TCTTTGGTTATCTAGCTGTATG250590.45835925349211076No Hit
TCCCTGAGACCCTTAACCTG232420.4251241378212873No Hit
TGAGGTAGTAGGTTGTATAGT232170.4246668577487663No Hit
TACCCTGTAGAACCGAATTTGT226520.4143323281097926No Hit
AAGCTGCCAGCTGAAGAACT207040.37870106485895927No Hit
AACCCGTAGATCCGAACTTGTGA203160.37160407813343393No Hit
TTGCATAGTCACAAAAGTGATC201450.36847628243739056No Hit
TCCAGCATCAGTGATTTTGTT198320.36275113592942815No Hit
TATTGCACTTGTCCCGGCCTGT191910.3510264748699907No Hit
TCCCTGAGACCCTTAACCTGTGT189030.34575860843454925No Hit
AGCTGGTGTTGTGAATCAGGCCG186020.34025295636139685No Hit
AACATTCATTGCTGTCGGTGGGT185750.33975909388307424No Hit
TCCCTGAGACCCTAACTTGTG183900.3363752213464191No Hit
AGCTACATCTGGCTACTGGGTCT178250.3260406917074454No Hit
AACTCCAGTCACGCCAATATCT176560.3229494784172037Illumina PCR Primer Index 6 (100% over 22bp)
CCCTGCGACCCTTAACCTGTGA174600.31936440264863936No Hit
TTCACAGTGGCTAAGTTCTGC158110.28920220906515676No Hit
TACCCTGTAGATCCGGATTTGT156420.28611099577491506No Hit
ACCATCGACCGTTGACTGTGCC155040.2835868097745993No Hit
TGAGGTAGTTGGTTGTATAGTT152290.27855672897686873No Hit
CACCACGTTCCCGTGG150700.2756484277156354No Hit
AGCTACATTGTCTGCTGGGTTTC146430.2678380840769774No Hit
TAAAGGGAATTTGCGACTGTT145110.26542364529406676No Hit
TAACAGTCTACAGTCATGGCT142460.26057647652534455No Hit
TACCCTGTAGAACCGAATTTGCG134190.24544965172635116No Hit
TAAAGCTAGAGAACCGAAAGTAA133140.2435290754217631No Hit
AGCTACATTGTCTGCTGGGTTT126890.2320970736087391No Hit
TGAGATGAAGCACTGTAGCTCT125170.22895098670979488No Hit
TGAGATGAAGCACTGTAGCTC122770.22456109801359367No Hit
CTGGACAACTCTTAGCGG121450.222146659230683No Hit
TTCAAGTAATCCAGGATAGGC119210.21804942978089517No Hit
CTGTCTGAGGGTCGCT117300.21455581002683502No Hit
CCTTGGCTTTAGACTGCTTACT116620.21331200822957802No Hit
TGTCTGAGGGTCGCT113950.20842825705505416No Hit
AACTCCAGTCACGCCAATATCTC110690.2024653249093808Illumina PCR Primer Index 6 (100% over 23bp)
TCCAGCATCAGTGATTTTGTTG108770.19895341395241983No Hit
TTCCCTTTGTCATCCTATGCCT106310.19445377803881359No Hit
TGAGATGAAGCACTGTAGCT103800.18986268611070312No Hit
TTCCCTTTGTCATCCTATGCCTG100330.18351563870411217No Hit
AACCCGTAGATCCGAACTTG100020.18294861141418617No Hit
TACCCTGTAGAACCGAATGTGT99980.18287544660258284No Hit
TAAAGCTAGAGAACCGAAAGTAT98650.18044271661677133No Hit
TTCACAGTGGCTAAGTTCTG96910.1772600473120254No Hit
TGAGGTAGTAGGTTGTGTGGTT96160.17588820709446254No Hit
AAGCTGCCAGTTGAAGAGCTGT95960.17552238303644577No Hit
TTCACCGTGGCTAAGTTCTGC95700.17504681176102396No Hit
AACTCCAGTCACGCCCATATCTCGTCTGC94110.17213851049979065Illumina PCR Primer Index 6 (96% over 25bp)
ACCGTGGCTTTAGATTGTTACT93860.17168123042726968No Hit
TCTTTGGTTATCTAGCTGTATGT93390.1708215438909303No Hit
CTTTGGTTATCTAGCTGTATGA89790.16423671084662844No Hit
AGAATAATGCCAGCAGTCGGTC89460.16363310115090077No Hit
AACTCCAGTCACGCCAATATCTCG89320.16337702431028903Illumina PCR Primer Index 6 (100% over 24bp)
TACCCTGTAGAACCGAATTTGC88610.1620783489043295No Hit
AACATTCAACGATGTCGGTGAG88530.1619320192811228No Hit
ACCACGTTCCCGTGG88370.16163936003470938No Hit
TGAGGTAGTAGGTTGTATAGTTT85220.15587763112094527No Hit
ACCATCGACCGTTGACTGTACC84160.1539387636134564No Hit
CTACGCCTGTCTGAGGGTCGCT82380.15068292949710715No Hit
TAAGGCACGCGGTGAATGCC82140.15024394062748703No Hit
TGAGGTAGTAGTTTGTGC79040.1445736677282271No Hit
AAGGTCCAACCTCACATGTCCT77300.1413909984234812No Hit
TGAGGTAGTTGGTTGTATTGTT72540.13268438584268213No Hit
TACCCTGTAGATCCGGATTTGTG70420.12880665082770437No Hit
TGGACAACTCTTAGCGG68820.12588005836357022No Hit
TACGACCTCAGATCAGACGAGA67570.1235936580009654No Hit
CAGGCTGGTTAGATGGTTGTCT65620.12002687343530191No Hit
TCCCTGAGACCCTTAACC65050.11898427486995411No Hit
AGCAGCATTGTACAGGGCTATGA64280.11757585224658956No Hit
TAGCTTATCAGACTGGTGTTGG64120.11728319300017614No Hit
TTTGGCAATGGTAGAACTCACA64000.11706369856536608No Hit
TCCCTGAGACCCTTAACCTGTGG63500.11614913842032416No Hit
TGTAAACATCCTTGACTGGAAGCT62940.1151248310578772No Hit
AACATTCAACGCTGTCGGTGG62700.11468584218825709No Hit
TAACAGTCTACAGCCATGGTCG62670.11463096857955457No Hit
ACCATCGACCGTTGACTGTGCCT61690.1128384306952724No Hit
AACATTCAACGCTGTCGGTGAGA61040.11164950250671789No Hit
TTCAAGTAATCAAGGATAGGCT60870.11133855205740364No Hit
TATTGCACTCGTCCCGGCCTC58750.1074608170424259No Hit
TGCTCAGTAGTCAGTGTAGATCC58070.10621701524516887No Hit
TAGCAGCACGTAAATATTGGAG56670.10365624683905149No Hit
TTCAAGTAATCCAGGATAGGTT55940.10232098902729028No Hit
TTCACCGTGGCTAAGTTCTG55150.10087598399812406No Hit
TGAGGTAGTAGATTGAATAGTT55060.10071136317201651No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTTTGC251.1277734E-10382.369323
CGTATTC103.8897034E-4382.3692623
CGTATGC143450.0376.638423
CGTCTGC40300.0374.304423
CGTGTGC1350.0354.0456223
TCGTATG144850.0309.320222
ATCACTA3150.0305.7269322
ATCACTG2650.0303.835622
TCGTCTG41250.0303.5034222
ATAACTA4550.0301.8715822
TCGTGTG1400.0281.9203222
TAACTGC550.0278.0867623
TAATAAC400.0276.281922
AGGCATA258.967618E-10270.216521
TCCCGAA100.0011005467270.2164621
ATACCTA100.0011005467270.2164621
GTATGCC2200.0269.3965523
CTCGTCT40500.0264.2116721
CTCGTAT151300.0260.4829721
ATCAACA251.3391946E-7252.6005922