FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_12_JM109_1_CAGATC_L008_R1_001_TRIMMED_prinseq_good_ZwF8.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_12_JM109_1_CAGATC_L008_R1_001_TRIMMED_prinseq_good_ZwF8.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6174886
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG5877119.517762757077621No Hit
TTCAAGTAATCCAGGATAGGCT3174345.140726484667085No Hit
AACATTCAACGCTGTCGGTGAGT2696204.3663963998687585No Hit
AACCCGTAGATCCGAACTTGTG1983943.2129176149972647No Hit
TGAGGTAGTAGGTTGTATAGTT1727442.797525330832019No Hit
TCACAGTGAACCGGTCTCTTT1317962.134387582216093No Hit
TAAAGCTAGAGAACCGAAAGTA1153711.8683907686716807No Hit
TCCCTGAGACCCTTAACCTGT1082651.7533117210584939No Hit
TAAAGCTAGAGAACCGAAAGT960131.5548951025168722No Hit
TCCCTGAGACCCTTAACCTGTG808261.3089472421029311No Hit
AACATTCAACGCTGTCGGTGA755561.2236015369352566No Hit
AACCCGTAGATCCGAACTTGT663101.0738659790642289No Hit
TAAAGCTAGAGAACCGAAAGTC605660.9808440188207522No Hit
TATTGCACTCGTCCCGGCCTCC512050.8292460783891394No Hit
AGCTACATCTGGCTACTGGGTCTC470060.7612448229813473No Hit
AACANTCAACGCTGTCGGTGAG461880.747997614854752No Hit
TCCAGCATCAGTGATTTTGTT424690.6877697823085317No Hit
AACAGTCAACGCTGTCGGTGAG420810.6814862654954278No Hit
TCTTTGGTTATCTAGCTGTATGA413550.6697289634173004No Hit
TGAGGTAGTAGTTTGTATAGTT401810.6507164666683725No Hit
TTAAAGGGAATTTGCGACTGTT377950.6120760771939757No Hit
TCTTTGGTTATCTAGCTGTAT375960.6088533456326157No Hit
ACCTTGGCTTTAGACTGCTTACT359740.5825856542128874No Hit
TGAGGTAGTAGTTTGTGCTGTT353710.5728202917430378No Hit
TCCCTGAGACCCTTAACCTGTGA351220.5687878286335974No Hit
TAGCTTATCAGACTGGTGTTGGC344210.5574353923295102No Hit
AACATTCATTGCTGTCGGTGGG334200.5412245667369406No Hit
CCACGTTCCCGTGG328810.5324956606486339No Hit
TTGCATAGTCACAAAAGTGATC322080.5215966740114716No Hit
TGAGGTAGTAGGTTGTATAGT301190.4877660899326724No Hit
TACCCTGTAGAACCGAATTTGT297410.4816445194291846No Hit
AACCCGTAGATCCGAACTTGTGA284610.46091539179832636No Hit
TCCCTGAGACCCTAACTTGT277340.4491418950892373No Hit
TCACAGTGAACCGGTCTCTTTT254340.4118942438775388No Hit
TTCACAGTGGCTAAGTTCTGC249440.40395887470635083No Hit
TGAGGTAGTTGGTTGTATAGTT245930.39827455923882643No Hit
TCACAGTGAACCGGTCTCTT243180.3938210357243842No Hit
TTCANGTAATCCAGGATAGGCT237220.3841690356712658No Hit
TTCAGGTAATCCAGGATAGGCT233540.3782094114773941No Hit
TCTTTGGTTATCTAGCTGTATG225220.3647354785173362No Hit
CCTGTCTGAGGGTCGCT215400.3488323509130371No Hit
TCCCTGAGACCCTAACTTGTGA211670.34279175356435726No Hit
TAACAGTCTACAGTCATGGCT211020.3417391025518528No Hit
TACCCTGTAGATCCGGATTTGT209080.33859734414530085No Hit
AACTCCAGTCACCAGATCATCTCGTATGC205680.33309116961835405Illumina PCR Primer Index 7 (100% over 29bp)
AACANTCAACGCTGTCGGTGAGT205400.33263771995142905No Hit
TGAGATGAAGCACTGTAGCT197850.320410773575415No Hit
AAGCTGCCAGCTGAAGAACTGT197500.31984396149175875No Hit
AACATTCATTGCTGTCGGTGGGT196190.31772246483578803No Hit
AACAGTCAACGCTGTCGGTGAGT194100.31433778696481196No Hit
TTCAAGTAATCCAGGATAGGC182690.2958597130376172No Hit
TCCCTGAGACCCTAACTTGTG180520.2923454781189483No Hit
TTCACAGTGGCTAAGTTCTG173640.28120357201736196No Hit
CCCTGAGACCCTTAACCTGTGA171030.27697677333638226No Hit
TCCAGCATCAGTGATTTTGTTG169870.2750981961448357No Hit
TAAAGGGAATTTGCGACTGTT169620.2746933303707955No Hit
TAAAGCTAGAGAACCGAAAGTAA169610.27467713573983393No Hit
TGAGATGAAGCACTGTAGCTCT162020.2623854108399734No Hit
TCCCTGAGACCCTTAACCTG159750.25870922961168835No Hit
AAGCTGCCAGCTGAAGAACT159620.25849869940918746No Hit
AGCTACATCTGGCTACTGGGTCT155200.2513406725241567No Hit
AGCTGGTGTTGTGAATCAGGCCG153360.24836086042722083No Hit
TGAGATGAAGCACTGTAGCTC152320.2466766188072136No Hit
AACCNGTAGATCCGAACTTGTG151330.2450733503420144No Hit
TATTGCACTTGTCCCGGCCTGT146080.23657116908717019No Hit
TAAAGCTAGAGAACCGAAAGTAT145030.23487073283620136No Hit
AACCGGTAGATCCGAACTTGTG143950.2331217126923477No Hit
CCTTGGCTTTAGACTGCTTACT136270.22068423611383273No Hit
TTCACCGTGGCTAAGTTCTGC135930.22013361866113804No Hit
TACCCTGTAGAACCGAATTTGCG133350.21595540387304318No Hit
TCCCTGAGACCCTTAACCTGTGT129880.21033586692936518No Hit
AGAATAATGCCAGCAGTCGGTC127690.206789242748773No Hit
AGCTACATTGTCTGCTGGGTTT123670.2002790011022066No Hit
TGAGNTAGTAGGTTGTATAGTT123280.19964741049470386No Hit
TTCCCTTTGTCATCCTATGCCT117540.19035169232274085No Hit
AGCTACATTGTCTGCTGGGTTTC117100.18963912856043008No Hit
TGAGGTAGTAGGTTGTATAGTTT115340.1867888735111871No Hit
TCCCTGAGACCCTAACTTGTGC112680.18248110167539935No Hit
TGAGGTAGTTGGTTGTATTGTT112560.18228676610386005No Hit
AACCCGTAGATCCGAACTTG111470.1805215513290448No Hit
TCTTTGGTTATCTAGCTGTATGT110930.17964704125711795No Hit
TACCCTGTAGAACCGAATTTGC110290.17861058487557502No Hit
TAAGGCACGCGGTGAATGCC108140.1751287392188293No Hit
ACCGTGGCTTTAGATTGTTACT108070.17501537680209805No Hit
TACCCTGTAGAACCGAATGTGT106750.17287768551516577No Hit
CACTCCAGTCACCAGATCATCTCGTATGC106370.17226228953862469Illumina PCR Primer Index 7 (96% over 29bp)
AACAATCAACGCTGTCGGTGAG105990.17164689356208357No Hit
ACCATCGACCGTTGACTGTGCC101670.16465081298666892No Hit
TCACNGTGAACCGGTCTCTTT98690.1598248129601097No Hit
TTCACCGTGGCTAAGTTCTG96980.15705553106567471No Hit
AAGGTCCAACCTCACATGTCCT94460.15297448406334951No Hit
TCACGGTGAACCGGTCTCTTT93920.15209997399142267No Hit
TAAAGCTAGAGAACCGAAAGTCA90050.14583265180928037No Hit
CCCTGCGACCCTTAACCTGTGA89870.1455411484519714No Hit
TAGCTTATCAGACTGGTGTTGG89430.14482858468966067No Hit
AAGCTGCCAGTTGAAGAGCTGT89370.14473141690389102No Hit
CTGGACAACTCTTAGCGG87410.14155726923541584No Hit
CCCTGAGACCCTTAACCTGTGC87090.14103904104464438No Hit
TGAGGTAGTAGGTTGTGTGGTT83610.13540330947000478No Hit
TCCCNGAGACCCTTAACCTGT82640.1338324302667288No Hit
TAAANCTAGAGAACCGAAAGTA81330.13171093361075817No Hit
TGAGGTAGTAGATTGAATAGTT80510.1303829738719063No Hit
TCCCGGAGACCCTTAACCTGT79690.12905501413305445No Hit
TTCAAGTAATCCAGGATAGGTT78740.12751652419170167No Hit
CATTATTACTTTTGGTACGCG78500.1271278530486231No Hit
TGTAAACATCCTTGACTGGAAGCT78100.12648006781015877No Hit
AGCAGCATTGTACAGGGCTATGA76110.12325733624879875No Hit
TACCCTGTAGATCCGGATTTGTG75130.12167026241456118No Hit
TAAAGCTAGAGAACCGAAAGTCT74480.12061761140205667No Hit
CACCACGTTCCCGTGG73970.11979168522301466No Hit
TTCCCTTTGTCATCCTATGCCTG73460.11896575904397264No Hit
TGAGGTAGTAGTTTGTGC72690.11771877245992882No Hit
CTTTGGTTATCTAGCTGTATGA72130.11681187312607877No Hit
TAAANCTAGAGAACCGAAAGT71010.11499807445837866No Hit
TTCAAGTAATCCAGGATAGGCTT70440.11407498049356701No Hit
AGAATCATGCCAGCAGTCGGTC69860.11313569189779374No Hit
ACCTTGGCTCTAGACTGCTTACT69130.11195348383759636No Hit
ACCATCGACCGTTGACTGTACC67780.10976720865777928No Hit
AACATTCAACGCTGTCGGTGAGA67750.10971862476489445No Hit
TTGCATAGTCACAAAAATGAGC66860.10827730260931133No Hit
ACCATCGACCGTTGACTGTGCCT66250.10728943012065324No Hit
AACCCGTAGATCCGAACTTGTGT65500.10607483279853264No Hit
TATGGCTTTTTATTCCTATCTG63970.10359705426140661No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AAATAGC159.586074E-91547.262123
TTCTATG50.00341761481547.261823
CACTAAT50.00341761481547.261823
ACGGAGT50.00341761481547.261823
GTTGCCA50.00341761481547.261823
TACCGAT50.00341761481547.261823
CGTATGC34500.01522.595323
CAACCCG750.01340.960323
TAACTAA254.7293724E-111237.809623
AATAACC1050.01178.866223
GCTGAGC203.0282536E-81160.446423
TTAATGC50.00689278781089.533922
GGCCGCG50.00689278781089.533922
CGTCTTT50.00689278781089.533922
TGGCCCC50.00689278781089.533922
AAAACAC101.683818E-51089.533922
ATCAACA153.901914E-81089.533922
AGCGCGC50.00689278781089.533922
CAAATAG101.683818E-51089.533922
TACTCTC50.00689278781089.533922