FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_12_JM113_1_ACTTGA_L001_R1_001_TRIMMED_prinseq_good_c1tb.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_12_JM113_1_ACTTGA_L001_R1_001_TRIMMED_prinseq_good_c1tb.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2378628
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG1614336.786811556914323No Hit
TTCAAGTAATCCAGGATAGGCT1358695.712074355468783No Hit
AACATTCAACGCTGTCGGTGAGT839953.531237335136053No Hit
TGAGGTAGTAGGTTGTATAGTT794753.3412118246316784No Hit
AACCCGTAGATCCGAACTTGTG587912.471634908863429No Hit
TCACAGTGAACCGGTCTCTTT586152.4642356854455594No Hit
TCCCTGAGACCCTTAACCTGT553882.3285692424372373No Hit
TAAAGCTAGAGAACCGAAAGTA412251.7331419625094804No Hit
TCCCTGAGACCCTTAACCTGTG337171.4174978180699125No Hit
TAAAGCTAGAGAACCGAAAGT311101.307896821192721No Hit
AACATTCAACGCTGTCGGTGA290961.2232261623086922No Hit
TATTGCACTCGTCCCGGCCTCC235230.9889314344235416No Hit
TGAGGTAGTAGTTTGTGCTGTT234850.9873338748219561No Hit
AACCCGTAGATCCGAACTTGT219370.9222543415784225No Hit
TGAGGTAGTAGGTTGTATAGT205190.8626401438139969No Hit
AGCTACATCTGGCTACTGGGTCTC204950.8616311588024693No Hit
TTCAAGTAATCAAGGATAGGCT203590.8559135770704792No Hit
CCACGTTCCCGTGG202120.8497335438748724No Hit
TAAAGCTAGAGAACCGAAAGTC160680.6755154652177642No Hit
TTAAAGGGAATTTGCGACTGTT155680.6544949441442715No Hit
TGAGGTAGTAGTTTGTATAGTT153980.6473479669792839No Hit
TGAGGTAGTTGGTTGTATAGTT147200.6188441404036276No Hit
TCCAGCATCAGTGATTTTGTT144170.606105704633091No Hit
TCCCTGAGACCCTTAACCTGTGA140970.5926525711460556No Hit
ACCTTGGCTTTAGACTGCTTACT137030.5760884005401433No Hit
AACTCCAGTCACACTTGAATCTCGTATGC136980.5758781953294083Illumina PCR Primer Index 8 (100% over 29bp)
AACATTCATTGCTGTCGGTGGG129080.5426657720332898No Hit
TACCCTGTAGAACCGAATTTGT125500.527615078944669No Hit
TCCCTGAGACCCTAACTTGT125050.5257232320480546No Hit
AACATTCAACGATGTCGGTGAG122440.5147505200476914No Hit
TCTTTGGTTATCTAGCTGTAT118840.49961574487477656No Hit
TCACAGTGAACCGGTCTCTTTT118340.4975136927674273No Hit
TCTTTGGTTATCTAGCTGTATGA110180.46320820237548704No Hit
TTCACAGTGGCTAAGTTCTGC109930.46215717632181236No Hit
TCACAGTGAACCGGTCTCTT107880.45353876268168036No Hit
CCCTGAGACCCTTAACCTGTGA104220.4381517412558837No Hit
CCTGTCTGAGGGTCGCT104170.43794153604514874No Hit
TAGCTTATCAGACTGGTGTTGGC103640.4357133608113585No Hit
TACCCTGTAGATCCGGATTTGT92360.38829106526955876No Hit
TAACAGTCTACAGTCATGGCT90780.381648580610335No Hit
AACATTCNACGCTGTCGGTGAG90240.3793783643343978No Hit
TCTTTGGTTATCTAGCTGTCT88120.37046566339923687No Hit
AAGCTGCCAGCTGAAGAACTGT86890.3652946152151576No Hit
TCCCTGAGACCCTAACTTGTGA86890.3652946152151576No Hit
TCTTTGGTTATCTAGCTGTCTGA83340.35037004525297777No Hit
TCACAGTGAACAGGTCTCTTT81710.3435173553830191No Hit
AACCCGTAGATCCGAACTTGTGA81210.3414153032756698No Hit
AACATTCATTGCTGTCGGTGGGT80870.33998590784267235No Hit
TGAGGTAGTTGGTTGTATTGTT78740.3310311658653644No Hit
TTCAAGTNATCCAGGATAGGCT78010.32796216978863446No Hit
TATTGCACTTGTCCCGGCCTGT77000.3237160245317889No Hit
TTCAAGTAATCCAGGATAGGC74750.31425679004871715No Hit
TTCACAGTGGCTAAGTTCTG73960.3109355477191053No Hit
TAAAGGGAATTTGCGACTGTT70340.2957166904618965No Hit
AAGCTGCCAGCTGAAGAACT70250.2953383210825737No Hit
TTGCATAGTCACAAAAGTGATC69780.2933623921016653No Hit
TCCCTGAGACCCTAACTTGTG68530.28810726183329216No Hit
TCCAGCATCAGTGATTTTGTTG68350.28735052307464637No Hit
TCTTTGGTTATCTAGCTGTATG67420.28344070615497674No Hit
TCCCTGAGACCCTTAACCTG65800.27663005732716506No Hit
AACTCCAGTCACACTTGAATCTCGTCTGC65610.2758312775263724Illumina PCR Primer Index 8 (96% over 29bp)
TACCCTGTAGAACCGAATTTGCG65420.2750324977255796No Hit
TCCCTGAGACCCTTAACCTGTGT62580.2630928417558357No Hit
AACCCGTAGATACGAACTTGTG62540.2629246775872478No Hit
AACATTCAACGATGTCGGTGAGT61380.25804791669819743No Hit
AGCTACATTGTCTGCTGGGTTT58680.24669683531851136No Hit
AGCTGGTGTTGTGAATCAGGCCG58580.24627642489704146No Hit
TAAAGCTAGAGAACCGAAAGTAA55560.23358003016865186No Hit
TGAGATGAAGCACTGTAGCT54880.2307212393026568No Hit
TCCCTGAGACCATTAACCTGT54720.23004858262830508No Hit
AGCTACATCTGGCTACTGGGTCT54630.22967021324898218No Hit
TTGCATAGTCACAAAAGTGCTC53780.22609672466648842No Hit
TACCCTGTAGAACCGAATGTGT52800.22197670253608381No Hit
AGAATAATGCCAGCAGTCGGTC52160.21928607583867674No Hit
AGCTACATTGTCTGCTGGGTTTC50620.21281175534804098No Hit
TGAGGTAGTAGGTTGTATAGTTT50390.21184481137866032No Hit
TACCCTGTAGAACCGAATTTGC49660.20877581530193037No Hit
TCTTTGGTTATCTAGCTGTCTG49370.20755662507966777No Hit
TGAGATGAAGCACTGTAGCTCT48740.20490803942440772No Hit
TGAGATGAAGCACTGTAGCTC47570.19998923749321038No Hit
TTCCCTTTGTCATCCTATGCCTG46560.19574309223636482No Hit
AACATTCNACGCTGTCGGTGAGT46480.19540676389918896No Hit
TGAGGTANTAGGTTGTATAGTT45850.19275817824392885No Hit
TGAGGTAGTAGGTTGTGTGGTT45850.19275817824392885No Hit
TAAAGCTAGAGAACCGAAAGTAT45060.18943693591431698No Hit
TTCCCTTTGTCATCCTATGCCT45050.18939489487217No Hit
TGAGGTAGTTGGTTGTATAGT41450.1742601196992552No Hit
CCCTGAGACCCTTAACCTGTGC40620.17077071320105539No Hit
ACCATCGACCGTTGACTGTGCC40400.16984581027382173No Hit
CACTCCAGTCACACTTGAATCTCGTATGC40200.169004989430882Illumina PCR Primer Index 8 (96% over 29bp)
TAGCTTATCAGACTGGTGTTGG39980.16808008650364833No Hit
TGAGGTAGTAGATTGAATAGTT39240.1649690493847714No Hit
AACCCGTAGATCCGAACTTG38540.1620261764344824No Hit
TGAGGTAGTAGTTTGTGCTGT37910.1593775907792223No Hit
TCTTTGGTTATCTAGCTGTATGT37750.15870493410487055No Hit
TACCCTGTAGATCCGGATTTGTG37400.15723349762972605No Hit
TCCCTGAGACCCTAACTTGTGC36040.151515915897736No Hit
TGAGGTAGTAGTTTGTGCTGTTT35610.14970815108541563No Hit
TGAGGTAGTAGTTTGTGC35440.14899345336891687No Hit
TAAGGCACGCGGTGAATGCC34960.14697548334586158No Hit
TTCAAGTAATCCAGGATAGGCTT34150.14357015893195574No Hit
TTCAAGTAATCCAGGATAGGTT33730.14180443516178234No Hit
TCACAGTNAACCGGTCTCTTT33320.14008075243375592No Hit
ACCGTGGCTTTAGATTGTTACT33260.13982850618087403No Hit
TTCACCGTGGCTAAGTTCTGC33240.13974442409658006No Hit
CTTTGGTTATCTAGCTGTATGA32430.13633909968267421No Hit
AACCCGTNGATCCGAACTTGTG32070.13482562216538274No Hit
CCTTGGCTTTAGACTGCTTACT31860.13394276028029603No Hit
TGAGGTAGTTGTTTGTACAGTT31420.13209295442582866No Hit
CCCTGCGACCCTTAACCTGTGA30520.12830926063259995No Hit
TCCCTGAGACCATTAACCTGTG30330.12751048083180724No Hit
TCCCTGANACCCTTAACCTGT30270.12725823457892532No Hit
AAGCTGCCAGTTGAAGAGCTGT30270.12725823457892532No Hit
TAGCAGCACGTAAATATTGGAG29660.1246937310079592No Hit
TGTCTGAGGGTCGCT29390.12355862286999059No Hit
CACTCCAGTCACACTTGAATCTCGTCTGC29000.12191902222625815Illumina PCR Primer Index 8 (96% over 25bp)
CATTATTACTTTTGGTACGCG28930.12162473493122926No Hit
CTGGACAACTCTTAGCGG28720.12074187304614258No Hit
TCTTTGGTTATCTAGCTGTCTGT27740.11662185091573798No Hit
CAGGCTGGTTAGATGGTTGTCT27680.11636960466285606No Hit
CACCACGTTCCCGTGG27110.1139732652604779No Hit
AACTCCAGTCACACTTGAATCTCG26120.10981120208792632Illumina PCR Primer Index 8 (100% over 24bp)
TGAGGTAGTAAGTTGTGTTGTT25900.10888629916069262No Hit
TGAGGTAGTAGGTTGTATGGTT25870.10876017603425167No Hit
AACCCGTAGATACGAACTTGT25550.10741486268554815No Hit
TAACGGAACCCATAATGCAGCTG25460.10703649330622528No Hit
ACCGTGGCTTTAGATTGTTCCT25300.10636383663187352No Hit
ACCTTGGCTCTAGACTGCTTACT25040.10527076953605187No Hit
TGTAAACATCCTACACTCTCAGCT24410.10262218388079178No Hit
AACTCCATTCACACTTGAATCTCGTATGC24210.10178136303785207Illumina PCR Primer Index 8 (96% over 29bp)
TAACAGTCTACAGCCATGGTCG24090.10127687053208825No Hit
ACCACGTTCCCGTGG23960.10073033698417744No Hit
AACATTCAACGCTGTCGGTGG23940.10064625489988345No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACCCG203.8380676E-10814.4883423
TAACTAA151.2444434E-7814.4883423
CGTATTC104.0221326E-5814.4883423
CGTATAC151.2444434E-7814.4883423
CGTCTCC104.0221326E-5814.4883423
ACAACCA104.0221326E-5814.4883423
CGTCTGC13850.0799.786423
CGTATGC21900.0797.752323
TAATAAC152.3434586E-7695.370422
ATCACTA106.4645414E-5695.3703622
CTAAACA106.4645414E-5695.3703622
TCGTATT106.4645414E-5695.3703622
CGATGTA106.4645414E-5695.3703622
TACTAAC106.4645414E-5695.3703622
TCGTCTG14050.0675.5733622
TCGTATG22450.0669.042322
ATAACTA650.0641.880422
ATCACTG600.0637.4228522
GTATGCC400.0610.866323
ATAATAA257.2759576E-12599.2021521