FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_20_JM75_1_GATCAG_L002_R1_001_TRIMMED_prinseq_good_mLZI.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_20_JM75_1_GATCAG_L002_R1_001_TRIMMED_prinseq_good_mLZI.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3590461
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG39583211.024545316047158No Hit
TTCAAGTAATCCAGGATAGGCT2267596.315595685345141No Hit
AACATTCAACGCTGTCGGTGAGT1940215.403790766700989No Hit
AACTCCAGTCACGATCAGATCTCGTATGC1072222.986301759022031Illumina PCR Primer Index 9 (100% over 29bp)
TCCCTGAGACCCTTAACCTGT1061082.9552751025564685No Hit
TCACAGTGAACCGGTCTCTTT714351.9895773829600154No Hit
TGAGGTAGTAGGTTGTATAGTT706471.9676303405050215No Hit
AACATTCAACGCTGTCGGTGA615681.714765875468359No Hit
AACCCGTAGATCCGAACTTGTG599941.6709274937118102No Hit
TAAAGCTAGAGAACCGAAAGTA573511.5973157764420782No Hit
AACTCCAGTCCCGATCAGATCTCGTATGC464221.292925894474275Illumina PCR Primer Index 9 (96% over 29bp)
TATTGCACTCGTCCCGGCCTCC438841.222238592760094No Hit
TAAAGCTAGAGAACCGAAAGT436301.2151642922733321No Hit
TCCCTGAGACCCTTAACCTGTG383461.0679965608873065No Hit
AACATTCATTGCTGTCGGTGGG342810.954779901522395No Hit
TACCCTGTAGAACCGAATTTGT326650.9097717535436258No Hit
AACCCGTAGATCCGAACTTGT324530.9038672192790842No Hit
AGCTACATCTGGCTACTGGGTCTC307170.8555168820939707No Hit
TTAAAGGGAATTTGCGACTGTT271000.7547777290994109No Hit
TCCCTGAGACCCTTAACCTGTGA249770.6956488317238372No Hit
CCACGTTCCCGTGG227350.6332055967186386No Hit
TGAGGTAGTAGTTTGTGCTGTT223130.6214522313429947No Hit
TCCCTGAGACCCTAACTTGT219050.6100887880414242No Hit
CCCTGAGACCCTTAACCTGTGA217380.6054375747292619No Hit
TACCCTGTAGATCCGGATTTGT213850.5956059681472657No Hit
AACATTCATTGCTGTCGGTGGGT194410.5414625030044888No Hit
TCCAGCATCAGTGATTTTGTT189100.5266733157664155No Hit
AACCCGTAGATCCGAACTTGTGA184560.5140286999357464No Hit
TGAGGTAGTAGGTTGTATAGT180570.5029159208246518No Hit
TCTTTGGTTATCTAGCTGTATGA175550.488934429311445No Hit
TGAGGTAGTAGTTTGTATAGTT172020.479102822729449No Hit
TCCCTGAGACCCTAACTTGTGA171940.4788800101156927No Hit
AAGCTGCCAGCTGAAGAACTGT170630.4752314535654335No Hit
TCACAGTGAACCGGTCTCTT170360.47447946099400606No Hit
TCTTTGGTTATCTAGCTGTAT170080.4736996168458591No Hit
ACCTTGGCTTTAGACTGCTTACT164730.45879902330090755No Hit
TCACAGTGAACCGGTCTCTTTT160070.44582018854960404No Hit
TAAAGCTAGAGAACCGAAAGTAA152940.42596201434857534No Hit
TACCCTGTAGAACCGAATGTGT148760.41432005527980953No Hit
TACCCTGTAGAACCGAATTTGCG146820.4089168493962196No Hit
CCCTGCGACCCTTAACCTGTGA145560.40540755072955814No Hit
TAGCTTATCAGACTGGTGTTGGC145470.40515688653908233No Hit
TCCCTGAGACCCTTAACCTG138500.3857443375655661No Hit
TATGGCTTTTTATTCCTATCTG135010.3760241372904482No Hit
TATTGCACTTGTCCCGGCCTGT132000.3676408126978681No Hit
AAGCTGCCAGCTGAAGAACT129970.3619869426238024No Hit
TAAAGGGAATTTGCGACTGTT118010.32867645686723795No Hit
TACCCTGTAGAACCGAATTTGC114570.3190955144757177No Hit
TTCAAGTAATCCAGGATAGGC111260.3098766425815515No Hit
TTCACAGTGGCTAAGTTCTGC110660.30820554797837935No Hit
TCCCTGAGACCCTTAACCTGTGT106110.29553308057099076No Hit
TTCACAGTGGCTAAGTTCTG101710.28327838681439516No Hit
TGAGATGAAGCACTGTAGCT94940.26442286937526965No Hit
TAAAGCTAGAGAACCGAAAGTAT92940.25885255403136254No Hit
AGCTGGTGTTGTGAATCAGGCCG92730.2582676709202523No Hit
TGAGGTAGTTGGTTGTATAGTT92230.2568750920842755No Hit
CCTGTCTGAGGGTCGCT91550.2549811848673471No Hit
ACCGTGGCTTTAGATTGTTACT88690.24701563392555995No Hit
TTCCCTTTGTCATCCTATGCCT87480.2436455931424962No Hit
TAACGGAACCCATAATGCAGCTG87310.24317211633826408No Hit
TCCCTGAGACCCTAACTTGTG87290.24311641318482502No Hit
AACATTCAACGCTGTCGGTGAGA86820.24180738907900687No Hit
TTGCATAGTCACAAAAGTGATC85860.23913363771393145No Hit
TAACAGTCTACAGTCATGGCT82230.22902351536474005No Hit
TCCAGCATCAGTGATTTTGTTG81990.2283550775234712No Hit
TGAGATGAAGCACTGTAGCTCT77780.2166295637245468No Hit
TCTTTGGTTATCTAGCTGTATG77340.21540409434888724No Hit
TTCACCGTGGCTAAGTTCTGC77300.2152926880420091No Hit
AACTCCAGTCACGCTCAGATCTCGTATGC76700.21362159343883697Illumina PCR Primer Index 9 (96% over 29bp)
ACCATCGACCGTTGACTGTGCC76240.21234042090973831No Hit
TAAGGCACGCGGTGAATGCC75460.21016799792561458No Hit
TGAGGTAGTAGGTTGTATAGTTT75300.209722372698102No Hit
TTCCCTTTGTCATCCTATGCCTG74050.20624092560816007No Hit
TACCCTGTAGATCCGGATTTGTG71910.2002806881901795No Hit
TTCACCGTGGCTAAGTTCTG71000.19774619470870175No Hit
CCTTGGCTTTAGACTGCTTACT70510.1963814674494445No Hit
TGAGATGAAGCACTGTAGCTC69830.19448756023251612No Hit
AGCTACATCTGGCTACTGGGTCT69610.19387482554468632No Hit
ACCATCGACCGTTGACTGTGCCT67600.1882766586240597No Hit
AACCCGTAGATCCGAACTTG65150.1814530223277735No Hit
AGAATAATGCCAGCAGTCGGTC64570.17983763087804044No Hit
AACATTCAACGCTGTCGGTGG64350.17922489619021068No Hit
TTCAAGTAATCCAGGATAGGCTT63230.17610551959762272No Hit
AACTCCAGTCCCGCTCAGATCTCGTATGC62650.17449012814788964No Hit
AGCTACATTGTCTGCTGGGTTT62440.1739052450367794No Hit
CATTGCACTTGTCTCGGTCTGA60960.16978321168228816No Hit
TACCCTGTAGCACCGAATTTGT60580.1687248517669458No Hit
AACATTCAACGATGTCGGTGAG59890.16680309297329785No Hit
AGCTACATTGTCTGCTGGGTTTC59090.16457496683573503No Hit
AACATTCAACGCTGTCGGTGT58450.16279246592568475No Hit
CTGGACAACTCTTAGCGG56130.15633090012675252No Hit
TATGGCTTTTTATTCCTATCTGA56100.15624734539659393No Hit
AAGCTGCCAGTTGAAGAGCTGT55360.15418632871934831No Hit
TACGACCTCAGATCAGACGAGA55250.1538799613754334No Hit
CACCACGTTCCCGTGG53260.14833749760824586No Hit
ACCATCGACCGTTGACTGTACC53170.14808683341777001No Hit
CAGGCTGGTTAGATGGTTGTCT51960.14471679263470624No Hit
AGCAGCATTGTACAGGGCTATGA51220.1426557759574606No Hit
TCTTTGGTTATCTAGCTGTATGT47600.13257350518498878No Hit
ACCCTGTAGAACCGAATTTGCG46190.12864643286753427No Hit
AACATTCAACGCTGTCGGTG44870.1249700247405556No Hit
CTTTGGTTATCTAGCTGTATGA44450.12380025851833512No Hit
GAATACCAGGTGCTGTAAGCTT44410.12368885221145696No Hit
TAACAGTCTACAGCCATGGTCG44390.1236331490580179No Hit
AGAATCATGCCAGCAGTCGGTC44220.12315967225378581No Hit
TGAGGTAGTTGGTTGTATTGTT42730.11900978732257501No Hit
TGTGGTCGGCGTCC42620.11870341997866012No Hit
AACATTCAACGCTGTCGGTGAT42280.11775646637019592No Hit
ACCTTGGCTCTAGACTGCTTACT41620.11591826230670657No Hit
TGAGGTAGTAGTTTGTGC41300.11502701185168143No Hit
TATTGCACTTGTCCCGGCCTGTT40570.11299384675115536No Hit
TTCAAGTAATCAAGGATAGGCT39650.11043150169295808No Hit
TGGACAACTCTTAGCGG39570.1102086890792018No Hit
TACCCTGTAGCTCCGGATTTGT39360.10962380596809156No Hit
TCTTTGGTTATCTAGCTGTA39060.10878825866650549No Hit
TCCCTGAGACCCTTAACCTGTGG38030.10591954626439336No Hit
AACATTCATTGCTGTCGGTGGGTT37830.10536251473000265No Hit
TATTGCACTCGTCCCGGCCTC37730.10508399896280729No Hit
TGAGGTAGTAGGTTGTGTGGTT37690.10497259265592913No Hit
TGAGGTAGTAGTTTGTGCTGTTT37220.10366356855011098No Hit
TCACAGTGAACCGGTCTCT36710.10224313813741467No Hit
TACCCTGTAGAACCGAATGTGTG36630.10202032552365838No Hit
TATTGCACTCGTCCCGGCCT36350.10124048137551138No Hit
TTCAAGTAATCCAGGATAGGTT36340.10121262979879185No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC174450.0299.628923
CGTATTC100.001086409271.3650822
ATCACTA1300.0271.3650822
ATCAACC100.001086409271.3650822
ATCAAAA151.0093254E-5271.3650822
TACTAAC100.001086409271.3650822
ATAAACC151.0093254E-5271.3650822
ATAAACA400.0271.3650822
ATAAAAA500.0271.3650822
ATCACTG1100.0271.3650522
TCGTATG174850.0268.261122
TCACTGA750.0262.385723
CAACCCG351.0913936E-11259.5023523
ATAACTA4200.0255.212422
GATACCA301.4551915E-11249.9553821
GATCCCA201.4109355E-7249.9553821
ATACTAA100.0013895888249.9553821
GGCTTCT151.4012525E-5249.9553821
AGGCATA301.4551915E-11249.9553821
GAAAAAC100.0013895888249.9553821