FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_20_JM79_1_TAGCTT_L003_R1_001_TRIMMED_prinseq_good_YHu1.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_20_JM79_1_TAGCTT_L003_R1_001_TRIMMED_prinseq_good_YHu1.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3304284
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG34179010.343844536365518No Hit
TTCAAGTAATCCAGGATAGGCT1773635.367668154432246No Hit
AACATTCAACGCTGTCGGTGAGT1706075.163206310353469No Hit
TCCCTGAGACCCTTAACCTGT1143823.461627390381698No Hit
AACCCGTAGATCCGAACTTGTG1070083.238462553460901No Hit
TGAGGTAGTAGGTTGTATAGTT1069973.23812965229381No Hit
TAAAGCTAGAGAACCGAAAGTA691472.0926470000762647No Hit
TCACAGTGAACCGGTCTCTTT642071.9431441123099586No Hit
TCCCTGAGACCCTTAACCTGTG618921.8730835485085422No Hit
AACATTCAACGCTGTCGGTGA547071.655638558913217No Hit
TAAAGCTAGAGAACCGAAAGT531951.609879780309441No Hit
AACCCGTAGATCCGAACTTGT435871.3191057427267148No Hit
CCACGTTCCCGTGG384221.1627935129062756No Hit
TATTGCACTCGTCCCGGCCTCC381111.1533814890003402No Hit
TCCCTGAGACCCTTAACCTGTGA326520.9881717188958333No Hit
TCCCTGAGACCCTAACTTGT279850.8469308328218761No Hit
TGAGGTAGTAGTTTGTGCTGTT254980.7716649053168554No Hit
TCCAGCATCAGTGATTTTGTT244460.739827448245974No Hit
AACATTCATTGCTGTCGGTGGG233810.7075965625230761No Hit
TGAGGTAGTAGTTTGTATAGTT232610.7039649134275383No Hit
AACCCGTAGATCCGAACTTGTGA231390.7002727368470749No Hit
CCTGTCTGAGGGTCGCT217240.6574495412621917No Hit
TGAGGTAGTAGGTTGTATAGT207710.6286081946951292No Hit
TTAAAGGGAATTTGCGACTGTT200240.6060011790754063No Hit
AGCTACATCTGGCTACTGGGTCTC199220.6029142773441992No Hit
TCCCTGAGACCCTAACTTGTGA187850.5685044021639787No Hit
TAAAGCTAGAGAACCGAAAGTC186570.5646306431287383No Hit
TACCCTGTAGAACCGAATTTGT178420.5399656930215441No Hit
TCTTTGGTTATCTAGCTGTATGA169860.5140599294733745No Hit
CCCTGAGACCCTTAACCTGTGA166410.5036189383237034No Hit
ACCTTGGCTTTAGACTGCTTACT160200.4848251542542954No Hit
AACATTCATTGCTGTCGGTGGGT154500.4675748210504908No Hit
TAGCTTATCAGACTGGTGTTGGC147770.44720732237301636No Hit
TCCCTGAGACCCTTAACCTG146130.4422440686091147No Hit
TCTTTGGTTATCTAGCTGTAT144130.43619132011655176No Hit
CCCTGCGACCCTTAACCTGTGA136420.4128579746777214No Hit
TCACAGTGAACCGGTCTCTT135660.41055793025054743No Hit
TCACAGTGAACCGGTCTCTTTT135470.40998291914375395No Hit
TTCACAGTGGCTAAGTTCTGC133500.40402096187857944No Hit
AAGCTGCCAGCTGAAGAACTGT130940.3962734438080988No Hit
TAAAGCTAGAGAACCGAAAGTAA125110.3786296819522777No Hit
TATTGCACTTGTCCCGGCCTGT124130.37566383519092184No Hit
TCCCTGAGACCCTTAACCTGTGT123440.3735756369609876No Hit
TGAGGTAGTTGGTTGTATAGTT121880.3688544931367885No Hit
TCCCTGAGACCCTAACTTGTG117260.35487264411896796No Hit
TACCCTGTAGATCCGGATTTGT116740.3532989295109016No Hit
TTCACCGTGGCTAAGTTCTGC115850.35060545643171104No Hit
AACTCCAGTCACTAGCTTATCTCGTATGC106070.32100751630307806Illumina PCR Primer Index 10 (100% over 29bp)
TGAGATGAAGCACTGTAGCT99170.30012553400373576No Hit
TTCAAGTAATCCAGGATAGGC96480.2919845872812385No Hit
AAGCTGCCAGCTGAAGAACT96330.29153063114429634No Hit
TAAAGCTAGAGAACCGAAAGTAT94430.28578052007636146No Hit
TACCCTGTAGAACCGAATTTGCG93370.28257256337530307No Hit
TGAGGTAGTAGGTTGTATAGTTT90950.2752487376993019No Hit
TAAAGGGAATTTGCGACTGTT90500.2738868692884752No Hit
TTCCCTTTGTCATCCTATGCCT90430.2736750230912355No Hit
TCCAGCATCAGTGATTTTGTTG90420.2736447593487727No Hit
TGAGATGAAGCACTGTAGCTCT88270.26713805471926744No Hit
TCTTTGGTTATCTAGCTGTATG84740.2564549536298938No Hit
TTCACAGTGGCTAAGTTCTG82880.2508258975318102No Hit
CACCACGTTCCCGTGG82000.2481626881950825No Hit
AGCTGGTGTTGTGAATCAGGCCG79990.24207967596005672No Hit
TGAGATGAAGCACTGTAGCTC77480.23448347660189017No Hit
TAACAGTCTACAGTCATGGCT76260.23079130002142673No Hit
TACCCTGTAGAACCGAATGTGT75170.2274925520929799No Hit
CTGGACAACTCTTAGCGG75000.22697806847111207No Hit
AACCCGTAGATCCGAACTTG74400.22516224392334314No Hit
ACCATCGACCGTTGACTGTGCC74160.22443591410423558No Hit
TTCCCTTTGTCATCCTATGCCTG73390.22210560593459885No Hit
TTCACCGTGGCTAAGTTCTG72510.21944239659787113No Hit
TACCCTGTAGAACCGAATTTGC67620.20464342653355463No Hit
AAGCTGCCAGTTGAAGAGCTGT60570.1833074880972701No Hit
TAAGGCACGCGGTGAATGCC59820.18103770741255898No Hit
TCCCTGAGACCCTAACTTGTGC59510.1800995313962117No Hit
ACCGTGGCTTTAGATTGTTACT59030.1786468717579966No Hit
AGAATAATGCCAGCAGTCGGTC56800.17189805718878887No Hit
TGAGGTAGTTGGTTGTATTGTT56080.16971906773146617No Hit
AGCTACATCTGGCTACTGGGTCT55180.16699533090981283No Hit
TGTCTGAGGGTCGCT51880.15700829589708393No Hit
ACCATCGACCGTTGACTGTACC51420.15561616374379442No Hit
AACATTCAACGCTGTCGGTGAGA51120.15470825146990996No Hit
TGAGGTAGTAGTTTGTGC50970.15425429533296775No Hit
CTGTCTGAGGGTCGCT50930.15413324036311649No Hit
AGCTACATTGTCTGCTGGGTTTC50340.1523476795578104No Hit
TTGCATAGTCACAAAAGTGATC49270.14910945911428922No Hit
ACCACGTTCCCGTGG49010.14832260181025603No Hit
AACTCCAGTCACTAGCTTATCTCGTCTGC48940.14811075561301631Illumina PCR Primer Index 10 (96% over 29bp)
AGAATCATGCCAGCAGTCGGTC48400.14647651352002433No Hit
TGAGGTAGTAGGTTGTGTGGTT48380.1464159860350987No Hit
TCTTTGGTTATCTAGCTGTATGT48130.1456593924735283No Hit
CCCTGAGACCCTTAACCTGTGC47690.14432778780516445No Hit
CTACGCCTGTCTGAGGGTCGCT47220.14290539190941212No Hit
ACCATCGACCGTTGACTGTGCCT47150.14269354571217244No Hit
AACCCGTAGATCCGAACTTGTGT47040.14236064454508146No Hit
TTCAAGTAATCCAGGATAGGCTT46380.14036323754253568No Hit
AGCTACATTGTCTGCTGGGTTT45320.13715528084147732No Hit
TACCCTGTAGATCCGGATTTGTG45170.13670132470453508No Hit
CCTTGGCTTTAGACTGCTTACT43000.13013409259010425No Hit
TCGTGTCTTGTGTTGCAGCCAGT42680.12916565283129416No Hit
CCCTGCGACCCTTAACCTGTGC41230.124777410174186No Hit
TGAGGTAGTAGATTGAATAGTT40970.1239905528701528No Hit
ACCTTGGCTCTAGACTGCTTACT38640.11693910087631693No Hit
CTTTGGTTATCTAGCTGTATGA38470.11642461725444907No Hit
TATTGCACTCGTCCCGGCCT38150.115456177495639No Hit
AACTCCAGTCACTAGCTTATCTCG38030.11509301258608522Illumina PCR Primer Index 10 (100% over 24bp)
TTCAAGTAATCCAGGATAGGTT37710.11412457282727513No Hit
TGAGGTAGTAGTTTGTGCTGTTT37650.11394299037249823No Hit
TCTTTGGTTATCTAGCTGTCTGA37380.11312586932600226No Hit
ACTGGACAACTCTTAGCGG36650.11091661612621674No Hit
TGGACAACTCTTAGCGG36450.11031134127696045No Hit
TAACAGTCTACAGCCATGGTC36420.11022055004957201No Hit
TCCCTGAGACCCTTAACC36170.10946395648800164No Hit
AACATTCAACGCTGTCGGTGG35880.10858630795658No Hit
AACATTCAACGCTGTCGGTGT35860.10852578047165437No Hit
TAACAGTCTACAGCCATGGTCG35110.10625599978694325No Hit
CAGGCTGGTTAGATGGTTGTCT34820.10537835125552161No Hit
AACATTCAACGCTGTCGGTGAT34570.10462175769395125No Hit
AAGGTCCAACCTCACATGTCCT34340.1039256916173065No Hit
TCCCTGAGACCCTAACTTGTGT34050.10304804308588486No Hit
TAGCTTATCAGACTGGTGTTGG33730.10207960332707479No Hit
TAAAGCTAGAGAACCGAAAGTCA33590.10165591093259539No Hit
CATTGCACTTGTCTCGGTCTGA33350.1009295811134878No Hit
TCCCTGAGACCCTTAACCTGTGG33300.10077826240117375No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACACCCA50.0054490051225.072123
CGGATAA50.0054490051225.072123
AGTATTT50.0054490051225.072123
TCAAACC50.0054490051225.072123
CGGCGCC50.0054490051225.072123
TAACTAA450.01225.072123
CTAATTA50.0054490051225.072123
CGAATGC50.0054490051225.072123
CGTATGG152.4328983E-81225.072123
CGTAAGC50.0054490051225.072123
GGGAACG50.0054490051225.072123
GGTACCA50.0054490051225.072123
ATTCACC50.0054490051225.072123
CCGGCGA50.0054490051225.072123
AATAACC250.01225.07223
CGTATGC18800.01195.748523
CGTCTGC9550.01090.378423
GTATGCC450.01088.95323
GATTCCT400.01071.938123
AAACACA300.01020.8934323