FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_20_JM84_1_GGCTAC_L005_R1_001_TRIMMED_prinseq_good_l1U7.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_20_JM84_1_GGCTAC_L005_R1_001_TRIMMED_prinseq_good_l1U7.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3335455
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG3088599.259876088869435No Hit
TTCAAGTAATCCAGGATAGGCT1968565.9019234257395174No Hit
AACATTCAACGCTGTCGGTGAGT1675225.022463202171817No Hit
TGAGGTAGTAGGTTGTATAGTT1092913.2766444158293244No Hit
TCACAGTGAACCGGTCTCTTT810012.4284842697622966No Hit
AACCCGTAGATCCGAACTTGTG768042.302654360499542No Hit
TCCCTGAGACCCTTAACCTGT738302.2134911129066346No Hit
TAAAGCTAGAGAACCGAAAGTA593791.7802368792263725No Hit
TCCCTGAGACCCTTAACCTGTG581191.7424609236221145No Hit
AACATTCAACGCTGTCGGTGA495481.4854944827617222No Hit
TATTGCACTCGTCCCGGCCTCC324950.9742299026669525No Hit
TAAAGCTAGAGAACCGAAAGT318460.9547722874390451No Hit
TCTTTGGTTATCTAGCTGTATGA317330.9513844438015203No Hit
TCCCTGAGACCCTTAACCTGTGA306910.920144328135142No Hit
AGCTACATCTGGCTACTGGGTCTC292860.8780211395446799No Hit
TGAGGTAGTAGTTTGTATAGTT244050.7316842829538999No Hit
TCTTTGGTTATCTAGCTGTAT242920.7282964393163751No Hit
TTAAAGGGAATTTGCGACTGTT237210.7111773356258742No Hit
AACATTCATTGCTGTCGGTGGG234750.7038020300079No Hit
TCCAGCATCAGTGATTTTGTT228890.6862332125602054No Hit
TCCCTGAGACCCTAACTTGTGA227840.6830852162598506No Hit
TGAGGTAGTAGGTTGTATAGT217110.650915692161939No Hit
CCCTGAGACCCTTAACCTGTGA201750.6048650034253198No Hit
AACCCGTAGATCCGAACTTGT197440.5919432281352919No Hit
TGAGGTAGTAGTTTGTGCTGTT196050.587775880651965No Hit
CCACGTTCCCGTGG188050.5637911469349759No Hit
TTCACAGTGGCTAAGTTCTGC177710.5327908786057673No Hit
TAGCTTATCAGACTGGTGTTGGC175040.5247859737277223No Hit
CCTGTCTGAGGGTCGCT174360.5227472713617782No Hit
TCACAGTGAACCGGTCTCTT172410.5169009925182622No Hit
ACCTTGGCTTTAGACTGCTTACT171970.5155818321638277No Hit
TCACAGTGAACCGGTCTCTTTT167430.5019704957794363No Hit
TGAGGTAGTTGGTTGTATAGTT165430.4959743123501891No Hit
TCTTTGGTTATCTAGCTGTATG161250.4834422889830623No Hit
TCCCTGAGACCCTAACTTGT152170.4562196162142796No Hit
AAGCTGCCAGCTGAAGAACTGT151300.453611276422557No Hit
AAGCTGCCAGCTGAAGAACT143660.43070585572283243No Hit
AACATTCATTGCTGTCGGTGGGT141540.4243499012878303No Hit
TTCACAGTGGCTAAGTTCTG131000.39275001461569714No Hit
TAAAGGGAATTTGCGACTGTT114000.3417824554670952No Hit
TTCAAGTAATCCAGGATAGGC112350.33683560413796615No Hit
TAACAGTCTACAGTCATGGCT108350.3248432372794716No Hit
AACCCGTAGATCCGAACTTGTGA108120.3241536761851082No Hit
TCCCTGAGACCCTAACTTGTG106690.31986640503319635No Hit
TTGCATAGTCACAAAAGTGATC104200.3124011566637835No Hit
TGAGATGAAGCACTGTAGCT104010.311831519238005No Hit
TATTGCACTTGTCCCGGCCTGT103150.30925316036342865No Hit
TAAAGCTAGAGAACCGAAAGTAA100800.30220764483406315No Hit
TCCAGCATCAGTGATTTTGTTG99810.2992395340365857No Hit
TGAGATGAAGCACTGTAGCTCT98400.2950122247189664No Hit
TGAGATGAAGCACTGTAGCTC95250.2855682358179019No Hit
TCCCTGAGACCCTTAACCTG91630.27471514381096435No Hit
TTCCCTTTGTCATCCTATGCCT87670.2628427006210547No Hit
AGCTACATTGTCTGCTGGGTTT86300.2587353149720203No Hit
TCTTTGGTTATCTAGCTGTATGT85190.25540743316878806No Hit
TGAGGTAGTAGGTTGTATAGTTT85150.2552875095002031No Hit
TAAAGCTAGAGAACCGAAAGTAT84400.2530389407142354No Hit
AGCTGGTGTTGTGAATCAGGCCG83700.2509402765139988No Hit
AGCTACATCTGGCTACTGGGTCT82930.24863174589373865No Hit
TCCCTGAGACCCTTAACCTGTGT80730.24203594412156665No Hit
AACATTCGGCGCTGTCGGTGAG79890.23951754708128278No Hit
AGCTACATTGTCTGCTGGGTTTC77420.23211226054616235No Hit
ACCGTGGCTTTAGATTGTTACT76700.22995363451163336No Hit
TTCCCTTTGTCATCCTATGCCTG76140.2282747031514441No Hit
AGAATAATGCCAGCAGTCGGTC74390.22302804265085271No Hit
TGAGGTAGTTGGTTGTATTGTT72460.21724172564162908No Hit
ACCATCGACCGTTGACTGTGCC71770.2151730423585388No Hit
TACCCTGTAGAACCGAATTTGT66990.20084216396263777No Hit
AAGCTGCCAGTTGAAGAGCTGT64650.19382662935041847No Hit
CCCTGCGACCCTTAACCTGTGA62750.18813025509263354No Hit
TTCACCGTGGCTAAGTTCTGC62390.18705094207536904No Hit
CCTTGGCTTTAGACTGCTTACT62270.1866911710696142No Hit
AACCCGTAGATCCGAACTTG61050.18303349917777334No Hit
TGTAAACATCCTTGACTGGAAGCT56670.1699018574677218No Hit
CTTTGGTTATCTAGCTGTATGA55710.1670236894216831No Hit
TTCAAGTAATCCAGGATAGGCTT53810.1613273151638982No Hit
TGAGGTAGTAGGTTGTGTGGTT52860.15847912803500572No Hit
TGCTCAGTAGTCAGTGTAGATCC51480.15434176146882508No Hit
TTCAAGTGGTCCAGGATAGGCT50580.15164347892566382No Hit
ACCATCGACCGTTGACTGTACC49380.14804576886811546No Hit
TAAGGCACGCGGTGAATGCC48170.14441807789342084No Hit
AACATTCAACGCTGTCGGTGG48120.14426817330768965No Hit
ACCATCGACCGTTGACTGTGCCT47410.14213952819030687No Hit
TTCACCGTGGCTAAGTTCTG47180.14144996709594343No Hit
AACATTCAACGCTGTCGGTGAGA47060.1410901960901886No Hit
TTCAAGTAATCCAGGATAGGTT47010.14094029150445742No Hit
TAGCTTATCAGACTGGTGTTGG45700.13701279135830044No Hit
AGCAGCATTGTACAGGGCTATGA45140.1353338599981112No Hit
TACGACCTCAGATCAGACGAGA44870.1345243752351628No Hit
AACATTCAGCGCTGTCGGTGAG44210.13254563470351122No Hit
CTGGACAACTCTTAGCGG43940.13173614994056285No Hit
TAACAGTCTACAGCCATGGTC43610.13074677967473702No Hit
TGAGGTAGTAGATTGAATAGTT42330.12690922228001877No Hit
TGAGGTAGTAGTTTGTGC42190.12648948943997146No Hit
AACATTCGGCGCTGTCGGTGAGT41830.12541017642270696No Hit
CACCACGTTCCCGTGG41810.12535021458841447No Hit
TGTCTGAGGGTCGCT41620.12478057716263599No Hit
TAACAGTCTACAGCCATGGTCG40730.12211227553662093No Hit
TGTAAACATCCTACACTCTCAGCT40170.12043334417643171No Hit
AACTCCAGTCACGGCTACATCTCGTATGC39200.11752519521324677Illumina PCR Primer Index 11 (100% over 29bp)
TGCTCAGTAGTCAGTGTAGATC38950.11677567228459086No Hit
TCCCTGAGACCCTTAACCTGTGG38810.11635593944454355No Hit
CTGTCTGAGGGTCGCT38510.11545651193015645No Hit
CAGGCTGGTTAGATGGTTGTCT37190.11149903086685325No Hit
TGAGGTAGTTGGTTGTATAGT36840.11044969876673498No Hit
TAACGGAACCCATAATGCAGCTG36760.11020985142956509No Hit
TGAGGTAGGAGGTTGTATAGTT36190.1085009391522296No Hit
AACATTCAACGCTGTCGGTGT36150.10838101548364465No Hit
AACATTCGACGCTGTCGGTGAG36120.10829107273220594No Hit
CATTGCACTTGTCTCGGTCTGA35610.1067620459577479No Hit
TATTGCACTCGTCCCGGCCTC35400.10613244669767694No Hit
TGAGGTAGTTGTTTGTACAGTT34170.10244479388868985No Hit
TGAGGTAGTAGGTTGTATGGTT34140.10235485113725114No Hit
AACATTCAACGCTGTCGGTG34010.10196509921435006No Hit
AAGGTCCAACCTCACATGTCCT33780.10127553811998663No Hit
CTACGCCTGTCTGAGGGTCGCT33570.10064593885991567No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA500.03048.425823
CGCATGC107.6403376E-73048.425523
CAACCCG107.6403376E-73048.425523
AAACAAA58.787721E-43048.425523
AACTGCA58.787721E-43048.425523
TCACTAA107.6403376E-73048.425523
GCATGCC58.787721E-43048.425523
CGTATGC4850.03016.998523
AATAACC350.02612.936323
TAACTGC201.9863364E-92286.319323
CGGATGC1100.02217.036923
CGTCTGC850.02151.829823
TCACTGA900.01862.926623
GCTTCCT254.8476068E-91829.055423
GATTCCT600.01778.248223
CTAGACC50.00314985821611.109522
TCGCATG105.1948264E-61611.109522
AACCCCA50.00314985821611.109522
CTTTTTC50.00314985821611.109522
CTTTTCT50.00314985821611.109522