FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_20_JM86_1_CTTGTA_L006_R1_001_TRIMMED_prinseq_good_5DRs.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_20_JM86_1_CTTGTA_L006_R1_001_TRIMMED_prinseq_good_5DRs.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7586710
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG7035619.273598173648393No Hit
TTCAAGTAATCCAGGATAGGCT4498745.929764021558752No Hit
AACATTCAACGCTGTCGGTGAGT3922545.170278025652753No Hit
TGAGGTAGTAGGTTGTATAGTT1753732.311581700104525No Hit
TCCCTGAGACCCTTAACCTGT1650692.175765252658926No Hit
TCACAGTGAACCGGTCTCTTT1610712.1230678383647192No Hit
AACATTCAACGCTGTCGGTGA1487711.9609422266041538No Hit
AACTCCAGTCACCTTGTAATCTCGTATGC1306411.7219717110578892Illumina PCR Primer Index 12 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTA1204601.587776519729896No Hit
TCCCTGAGACCCTTAACCTGTG1034701.3638322803955865No Hit
AACCCGTAGATCCGAACTTGTG996741.313797416798586No Hit
TATTGCACTCGTCCCGGCCTCC721030.9503856085180532No Hit
AACTCCAGTCACCTTGTAATCTCGTCTGC664190.8754651225630082Illumina PCR Primer Index 12 (96% over 29bp)
TCTTTGGTTATCTAGCTGTATGA658420.8678597178487117No Hit
TAAAGCTAGAGAACCGAAAGT623320.8215946042487454No Hit
AACATTCAAGGCTGTCGGTGAG576140.7594069102417254No Hit
AACATTCATTGCTGTCGGTGGG561450.7400441034387765No Hit
TTAAAGGGAATTTGCGACTGTT560950.7393850562364978No Hit
TCCCTGAGACCCTTAACCTGTGA559320.7372365623570691No Hit
CCCTGAGACCCTTAACCTGTGA495080.6525621778082991No Hit
AGCTACATCTGGCTACTGGGTCTC489960.6458135344569649No Hit
TCTTTGGTTATCTAGCTGTAT484430.6385244723997622No Hit
TGAGGTAGTAGTTTGTATAGTT466100.6143638019642242No Hit
TGAGGTAGTAGTTTGTGCTGTT457430.6029359234767112No Hit
CCACGTTCCCGTGG449520.5925097967366619No Hit
TGAGGTAGTAGGTTGTATAGT437250.576336778392742No Hit
TCCAGCATCAGTGATTTTGTT419140.5524660887262067No Hit
TCCCTGAGACCCTAACTTGTGA412640.5438984750965834No Hit
TTCAAGTAAGCCAGGATAGGCT365670.48198758091452026No Hit
AACATTCATTGCTGTCGGTGGGT361530.47653067007965244No Hit
ACCTTGGCTTTAGACTGCTTACT355700.4688461797010826No Hit
TCACAGTGAACCGGTCTCTT355500.4685825608201711No Hit
AAGCTGCCAGCTGAAGAACTGT352230.46427239211726823No Hit
TTCACAGTGGCTAAGTTCTGC347390.4578928151992102No Hit
TCCCTGAGACCCTAACTTGT332540.43831911329153217No Hit
TCACAGTGAACCGGTCTCTTTT326190.4299492138225924No Hit
AACATTCAAGGCTGTCGGTGAGT322310.4248350075329095No Hit
TAGCTTATCAGACTGGTGTTGGC315990.41650465089610644No Hit
AACCCGTAGATCCGAACTTGT306100.40346869723503337No Hit
TAACGGAACCCATAATGCAGCTG291560.38430360459276813No Hit
AAGCTGCCAGCTGAAGAACT288950.3808633781968732No Hit
TCTTTGGTTATCTAGCTGTATG276130.3639654079304468No Hit
TACCCTGTAGAACCGAATTTGT263960.34792419902698274No Hit
TGAGGTAGTTGGTTGTATAGTT261260.3443653441346776No Hit
TAAAGGGAATTTGCGACTGTT250030.3295631439714975No Hit
TTCACAGTGGCTAAGTTCTG244210.32189183453697323No Hit
TTCAAGTAATCCAGGATAGGC242750.31996741670631934No Hit
TAAAGCTAGAGAACCGAAAGTAA239390.31553861950700635No Hit
CCTGTCTGAGGGTCGCT231000.30447980745276937No Hit
TATTGCACTTGTCCCGGCCTGT229790.3028849132232549No Hit
TCCCTGAGACCCTTAACCTGTGT184690.24343885557771416No Hit
TACCCTGTAGATCCGGATTTGT181960.23984045785327238No Hit
TTCCCTTTGTCATCCTATGCCTG179740.23691428827515484No Hit
TCTTTGGTTATCTAGCTGTATGT178390.2351348608290023No Hit
TCCCTGAGACCCTTAACCTG177060.23338179527094088No Hit
TCCCTGAGACCCTAACTTGTG176350.23244594824370512No Hit
TGAGATGAAGCACTGTAGCTCT172150.22690995174456385No Hit
AACATTCAAAGCTGTCGGTGAG172030.22675178041601696No Hit
AACCCGTAGATCCGAACTTGTGA170770.2250909814662746No Hit
AGAATAATGCCAGCAGTCGGTC170260.22441875331995026No Hit
ACCGTGGCTTTAGATTGTTACT167650.22097852692405537No Hit
TGAGATGAAGCACTGTAGCT165720.21843460472325948No Hit
TAACAGTCTACAGTCATGGCT165320.2179073669614365No Hit
AGCTGGTGTTGTGAATCAGGCCG164190.21641792028428664No Hit
TTCCCTTTGTCATCCTATGCCT163750.21583795874628134No Hit
TGAGGTAGTGGGTTGTATAGTT158890.20943201994013216No Hit
TAAAGCTAGAGAACCGAAAGTAT157920.20815346836771143No Hit
AACATTCAACGCTGTCGGTGG156760.20662447885842478No Hit
TGAGATGAAGCACTGTAGCTC155780.2053327463419585No Hit
TCCAGCATCAGTGATTTTGTTG155580.205069127461047No Hit
TGAGGTAGTAGGTTGTATAGTTT152230.20065351120577957No Hit
TACCCTGTAGAACCGAATTTGCG149940.19763507501934305No Hit
AACATTCAACGCTGTCGGTGAGA143820.1895683372634515No Hit
CCTTGGCTTTAGACTGCTTACT143820.1895683372634515No Hit
AAGCTGCCAGTTGAAGAGCTGT143640.18933108027063114No Hit
TTCAAGTAATCCAGGATAGGCTT138710.18283287485616295No Hit
TTGCATAGTCACAAAAGTGATC131150.1728680811577087No Hit
ACCATCGACCGTTGACTGTGCC127940.16863699811907928No Hit
TACCCTGTAGAACCGAATGTGT127740.1683733792381678No Hit
TCCCTGAGAGCCTTAACCTGT126330.1665148661277418No Hit
CTTTGGTTATCTAGCTGTATGA125380.16526267644341222No Hit
TGAGGTAGTTGGTTGTATTGTT123180.16236286875338587No Hit
TACGACCTCAGATCAGACGAGA122170.16103159340478285No Hit
TCACAGTGAGCCGGTCTCTTT122160.16101841246073725No Hit
AGCTACATCTGGCTACTGGGTCT121300.15988485127281787No Hit
AACATTCAAGGCTGTCGGTGA117310.15462565459863367No Hit
AGCTACATTGTCTGCTGGGTTT116490.15354481718689658No Hit
AACTCCATTCACCTTGTAATCTCGTATGC113050.14901057243521895Illumina PCR Primer Index 12 (96% over 29bp)
ACCATCGACCGTTGACTGTACC110880.1461503075773293No Hit
TACCCTGTAGAACCGAATTTGC109940.1449112988370453No Hit
TTCAAGTAAACCAGGATAGGCT106610.14052204446986902No Hit
AGCTACATTGTCTGCTGGGTTTC103980.13705545618588294No Hit
CACCACGTTCCCGTGG103490.1364095899276498No Hit
AACATTCAACGCTGTCGGTG101300.133522963181669No Hit
TGAGGTAGTAGGTTGTGTGGTT99370.13097904098087312No Hit
TGAGGTAGTAGTTTGTGC99040.13054406982736919No Hit
AACATTCAACGCTGTCGGTGT98080.129278699198994No Hit
AACTCCATTCACCTTGTAATCTCGTCTGC97680.12875146143717103Illumina PCR Primer Index 12 (96% over 25bp)
AACATTCAAAGCTGTCGGTGAGT96740.12751245269688705No Hit
TAAAGCTAGGGAACCGAAAGTA92310.12167329448469759No Hit
TTCAAGTAATCCAGGATAGGTT91320.12036838102418572No Hit
AGCAGCATTGTACAGGGCTATGA90710.11956434343740568No Hit
CCCTGCGACCCTTAACCTGTGA89260.11765310655079739No Hit
CATTGCACTTGTCTCGGTCTGA88010.11600548854510057No Hit
AACATTCAACGCTGTCGGTGAT86900.11454240375604183No Hit
TCCCTGAGACCCTTAACCTGTGG85340.11248617648493221No Hit
TGTAAACATCCTACACTCTCAGCT85250.11236754798852203No Hit
TGCTCAGTAGTCAGTGTAGATCC85040.11209074816356497No Hit
ACCATCGACCGTTGACTGTGCCT84680.1116162341779243No Hit
TCCCTGAGAGCCTTAACCTGTG84140.11090446319946326No Hit
TAACAGTCTACAGCCATGGTCG83470.11002133994840978No Hit
TGAGGTAGTAGTTTGTGCTGTTT81570.10751696057975065No Hit
TGTAAACATCCTTGACTGGAAGCT81500.10742469397143162No Hit
CTGGACAACTCTTAGCGG80880.10660747544060602No Hit
TAAGGCACGCGGTGAATGCC80640.10629113278351222No Hit
CAGGCTGGTTAGATGGTTGTCT80200.10571117124550694No Hit
TACCCTGTAGATCCGGATTTGTG79600.10492031460277247No Hit
TGAGGTAGTAGATTGAATAGTT79420.10468305760995215No Hit
AACCCGTAGATCCGAACTTG78440.10339132509348584No Hit
AACCCGTAGGTCCGAACTTGTG78050.10287726827570845No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCACTAA400.0402.696723
ACATAGC103.3311022E-4402.696723
CGTCTGC93400.0399.2474423
CGTATGC171200.0395.640123
TAACTGC900.0380.3246823
TAACTAA650.0371.7200323
TACTAAC153.3406486E-6358.0063222
ATAACCA104.738847E-4358.0063222
ATAACAA104.738847E-4358.0063222
TCGTCTG93750.0353.6147522
ATCACTA4500.0350.0505722
TCGTATG173050.0349.524222
ATAACTA9400.0340.8676822
CTTCGTA203.3249307E-8334.0123321
GAACATA105.8336405E-4334.0123321
GAACAAA105.8336405E-4334.0123321
CGGATGC2850.0332.0481323
CTCGTCT93750.0329.7369421
CTCGTAT175900.0324.9926521
TAACACA253.9808583E-8322.1573523