FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_27_JM52_AGTCAA_L007_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_27_JM52_AGTCAA_L007_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6200725
Sequences flagged as poor quality0
Sequence length1-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG5096368.218974394123268No Hit
TTCAAGTAATCCAGGATAGGCT4921367.93674933173137No Hit
AACATTCAACGCTGTCGGTGAGT2899514.676082232319607No Hit
TGAGGTAGTAGGTTGTATAGTT1821222.9371081607392684No Hit
TCACAGTGAACCGGTCTCTTT1546602.49422446568748No Hit
TCCCTGAGACCCTTAACCTGT1492962.407718452277758No Hit
TAAAGCTAGAGAACCGAAAGTA1207601.9475142019683183No Hit
AACATTCAACGCTGTCGGTGA1108301.7873716379939442No Hit
TAAAGCTAGAGAACCGAAAGT806711.300993029040959No Hit
AACCCGTAGATCCGAACTTGTG775511.2506763322030892No Hit
TCCCTGAGACCCTTAACCTGTG757541.221695850082047No Hit
TCCAGCATCAGTGATTTTGTT676911.0916626684782829No Hit
CCACGTTCCCGTGG663581.0701651822972313No Hit
TCTTTGGTTATCTAGCTGTAT648721.0462002427135537No Hit
TTAAAGGGAATTTGCGACTGTT616140.9936579996693935No Hit
TCTTTGGTTATCTAGCTGTATGA545250.8793326586810414No Hit
AGCTACATCTGGCTACTGGGTCTC537810.8673340617427802No Hit
TGAGGTAGTAGGTTGTATAGT506930.817533433590427No Hit
TATTGCACTCGTCCCGGCCTCC491870.7932459510783012No Hit
AACATTCATTGCTGTCGGTGGG426060.6871132004725254No Hit
TACCCTGTAGAACCGAATTTGT425980.6869841833011463No Hit
TGAGGTAGTAGTTTGTATAGTT423890.6836136096988659No Hit
ACCTTGGCTTTAGACTGCTTACT391530.6314261638759984No Hit
TCACAGTGAACCGGTCTCTT389830.6286845489841913No Hit
TCCCTGAGACCCTTAACCTGTGA379750.612428385390418No Hit
TGAGGTAGTAGTTTGTGCTGTT375220.6051227880610734No Hit
TTGCATAGTCACAAAAGTGATC358050.5774324776538228No Hit
TCACAGTGAACCGGTCTCTTTT344160.5550318712731173No Hit
AACCCGTAGATCCGAACTTGT337710.544629861830673No Hit
CCCTGAGACCCTTAACCTGTGA331700.5349374468308141No Hit
TCCCTGAGACCCTAACTTGTGA330840.5335505122384883No Hit
TCCCTGAGACCCTAACTTGT322950.5208261937112192No Hit
TAAAGCTAGAGAACCGAAAGTAA308730.49789339149857476No Hit
CCTGTCTGAGGGTCGCT306290.49395836777151064No Hit
TTCAAGTAATCCAGGATAGGC286980.4628168480298675No Hit
TTCACAGTGGCTAAGTTCTGC270060.43552971628317655No Hit
AAGCTGCCAGCTGAAGAACT267430.4312882767740869No Hit
AACATTCATTGCTGTCGGTGGGT266730.4301593765245193No Hit
AAGCTGCCAGCTGAAGAACTGT266150.4292240020320205No Hit
TAAAGGGAATTTGCGACTGTT265440.42807897463603045No Hit
TACCCTGTAGATCCGGATTTGT260560.4202089271819021No Hit
TCTTTGGTTATCTAGCTGTATG253710.4091618318825621No Hit
TGAGGTAGTTGGTTGTATAGTT250680.40427530651657667No Hit
TAACAGTCTACAGTCATGGCT243860.3932765926565039No Hit
TATTGCACTTGTCCCGGCCTGT234770.3786170165585476No Hit
TTCACAGTGGCTAAGTTCTG231680.3736337283140278No Hit
ACCGTGGCTTTAGATTGTTACT215820.3480560740881107No Hit
TCCAGCATCAGTGATTTTGTTG209030.33710574166730506No Hit
CCCTGCGACCCTTAACCTGTGA195570.3153986025827625No Hit
TAAAGCTAGAGAACCGAAAGTAT187900.3030290812767862No Hit
TACCCTGTAGAACCGAATTTGCG185210.2986908788891622No Hit
TACCCTGTAGAACCGAATGTGT181840.2932560305448153No Hit
CCTTGGCTTTAGACTGCTTACT178500.2878695636397357No Hit
TAGCTTATCAGACTGGTGTTGGC176550.28472477008736885No Hit
AACCCGTAGATCCGAACTTGTGA172580.27832229295767835No Hit
TTCCCTTTGTCATCCTATGCCT172510.27820940293272156No Hit
AGCTACATTGTCTGCTGGGTTT172150.2776288256615154No Hit
TCCCTGAGACCCTTAACCTG164740.2656786101625213No Hit
TACCCTGTAGAACCGAATTTGC164350.26504965145204795No Hit
TGAGATGAAGCACTGTAGCT162930.262759596660068No Hit
TTCAAGTAATCCAGGATAGGCTT159180.25671191675167016No Hit
TCTTTGGTTATCTAGCTGTATGT159150.256663535312403No Hit
TTCACCGTGGCTAAGTTCTGC159070.25653451814102385No Hit
TGAGGTAGTAGGTTGTATAGTTT158410.25547012647714584No Hit
AGCTACATCTGGCTACTGGGTCT157700.2543250990811558No Hit
TGAGATGAAGCACTGTAGCTCT147730.23824633409802887No Hit
TTCACCGTGGCTAAGTTCTG139900.2256187784492942No Hit
TCCCTGAGACCCTAACTTGTG138570.22347386797511581No Hit
AGCTACATTGTCTGCTGGGTTTC137720.2221030605292123No Hit
TAAGGCACGCGGTGAATGCC137230.221312830354515No Hit
TCCCTGAGACCCTTAACCTGTGT136950.22086127025468796No Hit
TTCAAGTAATCAAGGATAGGCT135050.21779711243443306No Hit
TGAGGTAGTTGGTTGTATTGTT133650.21553931193529788No Hit
AAGCTGCCAGTTGAAGAGCTGT132500.21368469009672258No Hit
AGCTGGTGTTGTGAATCAGGCCG128870.2078305359453935No Hit
CATTGCACTTGTCTCGGTCTGA123500.19917025831656782No Hit
AACATTCAACGATGTCGGTGAG122720.19791234089562107No Hit
ACCATCGACCGTTGACTGTGCC122160.197009220695967No Hit
CTTTGGTTATCTAGCTGTATGA118940.19181627954795608No Hit
TTCCCTTTGTCATCCTATGCCTG118640.19133246515528426No Hit
AACATTCAACGCTGTCGGTGAGA117210.18902628321688192No Hit
CACCACGTTCCCGTGG115220.18581698107882547No Hit
TGAGGTAGTAGGTTGTGTGGTT112410.1812852529341327No Hit
TGAGATGAAGCACTGTAGCTC111670.18009184409887555No Hit
AGAATAATGCCAGCAGTCGGTC108030.17422156280112405No Hit
AACATTCAACGCTGTCGGTGG106760.17217341520548002No Hit
AACATTCAACGCTGTCGGTGT104090.16786746711070077No Hit
ACCATCGACCGTTGACTGTGCCT99020.15969100387454693No Hit
TTCAAGTAATCCAGGATAGGTT94040.15165968495619464No Hit
TTGCATAGTCACAAAAATGAGC94020.15162743066334985No Hit
TACGACCTCAGATCAGACGAGA93660.15104685339214366No Hit
AACATTCAACGCTGTCGGTG89470.14428957904116052No Hit
ACCATCGACCGTTGACTGTACC88080.14204790568844772No Hit
CTGGACAACTCTTAGCGG87270.1407416068282338No Hit
CAGGCTGGTTAGATGGTTGTCT87120.14049969963189787No Hit
AACCCGTAGATCCGAACTTG86020.13872571352543453No Hit
AGCAGCATTGTACAGGGCTATGA85050.13716138032246228No Hit
GTACAGTACTGTGATAACTGA84580.13640340444060975No Hit
TACCCTGTAGATCCGGATTTGTG84040.13553253853380048No Hit
TACAGTACTGTGATAACTGAAG83960.13540352136242134No Hit
TGAGGTAGTAGATTGAATAGTT83360.1344358925770777No Hit
TGTGGTCGGCGTCC81200.13095242894984052No Hit
TAACAGTCTACAGCCATGGTCG79810.12871075559712775No Hit
TGAGGTAGTTGGTTGTATAGT78640.12682387946570764No Hit
TGAGGTAGTAGTTTGTGC78280.12624330219450144No Hit
TAACGGAACCCATAATGCAGCTG77460.12492087618786513No Hit
TCACAGTGAACCGGTCTCT77120.12437255320950373No Hit
TGCTCAGTAGTCAGTGTAGATCC76770.12380810308471994No Hit
CTGTCTGAGGGTCGCT75940.12246954993166122No Hit
TGAGGTAGTTGTTTGTACAGTT72720.1172766087836503No Hit
AACATTCAACGCTGTCGGTGAT72720.1172766087836503No Hit
AGTTTTTGT72400.11676054009813368No Hit
TGAGGTAGTAGTTTGTGCTGTTT72210.1164541243161082No Hit
TGAGGTAGTAGTTTGTATAGT71830.11584129275205722No Hit
TGTCTGAGGGTCGCT71050.11458337533111046No Hit
AACATTCAACGATGTCGGTGAGT70680.11398667091348189No Hit
TATTGCACTTGTCCCGGCCTGTT70320.11340609364227569No Hit
TGTAAACATCCTTGACTGGAAGCT69390.11190626902499304No Hit
ACCACGTTCCCGTGG68820.11098702167891658No Hit
AGAATCATGCCAGCAGTCGGTC66140.10666494643771494No Hit
AACATTCATTGCTGTCGGTGGA66120.10663269214487017No Hit
TGCTCAGTAGTCAGTGTAGATC63900.10305246563909866No Hit
AACATTCAACGCTGTCGGTGAA62940.10150425958254881No Hit
TTTGGCAATGGTAGAACTCACA62240.10037535933298122No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCCCACA56.775062E-43473.768823
AAATAGC56.775062E-43473.768823
GCGCGCA56.775062E-43473.768823
ACACCCA105.1807547E-73473.768823
TAAACCC56.775062E-43473.768823
GCTGCGG56.775062E-43473.768823
AGTATTA56.775062E-43473.768823
TCACTAA56.775062E-43473.768823
CCCCACA56.775062E-43473.768823
CGCAACC56.775062E-43473.768823
GTAACTT56.775062E-43473.768823
CACTTCA56.775062E-43473.768823
TAACTAA200.03473.768823
CAACCCG350.02481.263423
TCACTGA2200.02368.478523
AATAACC600.02315.845723
TAACTGC550.01894.782823
GATGTAA100.00270950681736.884423
ACCATAT100.00270950681736.884423
GCGAAGA100.00270950681736.884423