FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_27_JM62_AGTTCC_L008_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_27_JM62_AGTTCC_L008_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4262072
Sequences flagged as poor quality0
Sequence length1-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG3290277.719883662218752No Hit
TTCAAGTAATCCAGGATAGGCT2764856.487102986528619No Hit
AACATTCAACGCTGTCGGTGAGT1909274.479675613175939No Hit
TGAGGTAGTAGGTTGTATAGTT1186342.783481837003223No Hit
TCACAGTGAACCGGTCTCTTT970272.276521841958559No Hit
TCCCTGAGACCCTTAACCTGT823351.9318068770307024No Hit
AACCCGTAGATCCGAACTTGTG679151.5934737845817715No Hit
AACATTCAACGCTGTCGGTGA600111.4080240784294586No Hit
TAAAGCTAGAGAACCGAAAGTA595971.3983104931122703No Hit
TAAAGCTAGAGAACCGAAAGT527681.2380832609115942No Hit
TCCCTGAGACCCTTAACCTGTG521321.2231609414388118No Hit
AGCTACATCTGGCTACTGGGTCTC448571.0524693153940148No Hit
TATTGCACTCGTCCCGGCCTCC367350.861904726151975No Hit
TCCAGCATCAGTGATTTTGTT349680.8204460178054241No Hit
TCTTTGGTTATCTAGCTGTAT327780.7690625592434853No Hit
TCTTTGGTTATCTAGCTGTATGA317060.7439104735912485No Hit
TAAAGCTAGAGAACCGAAAGTC313240.7349476968009926No Hit
TCCCTGAGACCCTTAACCTGTGA296840.696468759795705No Hit
CCACGTTCCCGTGG287170.6737802646224653No Hit
TGAGGTAGTAGGTTGTATAGT282430.6626589133172786No Hit
TGAGGTAGTAGTTTGTATAGTT266010.6241330507790577No Hit
TGAGGTAGTAGTTTGTGCTGTT259740.6094218962044752No Hit
TTAAAGGGAATTTGCGACTGTT252220.5917778958215628No Hit
AACANTCAACGCTGTCGGTGAG248310.5826039541331071No Hit
AACAGTCAACGCTGTCGGTGAG240700.564748788851995No Hit
AACATTCATTGCTGTCGGTGGG239450.5618159430436652No Hit
AACCCGTAGATCCGAACTTGT227620.5340594903136314No Hit
TCACAGTGAACCGGTCTCTT226030.530328910445436No Hit
TCACAGTGAACCGGTCTCTTTT213220.5002731066016717No Hit
TCCCTGAGACCCTAACTTGT211130.49536938841014416No Hit
TTCANGTAATCCAGGATAGGCT207830.48762667547615335No Hit
TTCAGGTAATCCAGGATAGGCT205210.481479430661894No Hit
TAGCTTATCAGACTGGTGTTGGC195370.4583920684587215No Hit
TTGCATAGTCACAAAAGTGATC192260.4510951480875968No Hit
ACCTTGGCTTTAGACTGCTTACT181950.4269050358604923No Hit
TCTTTGGTTATCTAGCTGTATG179170.42038238678276674No Hit
TTCACAGTGGCTAAGTTCTGC175710.41226426958530965No Hit
CCTGTCTGAGGGTCGCT174900.410363785501512No Hit
TTCAAGTAATCCAGGATAGGC173430.40691475883091605No Hit
AAGCTGCCAGCTGAAGAACTGT167070.39199243935813377No Hit
TCCCTGAGACCCTAACTTGTGA155190.36411867279576693No Hit
CCCTGAGACCCTTAACCTGTGA154560.3626405185083687No Hit
TGAGGTAGTTGGTTGTATAGTT153820.3609042737898374No Hit
AACATTCATTGCTGTCGGTGGGT151490.3554374492031106No Hit
AAGCTGCCAGCTGAAGAACT150800.3538185183169125No Hit
TATTGCACTTGTCCCGGCCTGT148460.34832823096371907No Hit
AACANTCAACGCTGTCGGTGAGT144730.3395766190716628No Hit
AACCCGTAGATCCGAACTTGTGA142870.335212544508868No Hit
TTCACAGTGGCTAAGTTCTG142510.334367884916069No Hit
AACAGTCAACGCTGTCGGTGAGT139770.32793908690421No Hit
TCCAGCATCAGTGATTTTGTTG134690.3160200015391575No Hit
AGCTACATCTGGCTACTGGGTCT123720.29028134672525474No Hit
TAACAGTCTACAGTCATGGCT123010.2886154903061234No Hit
TGAGATGAAGCACTGTAGCT116190.2726138835758758No Hit
TAAAGGGAATTTGCGACTGTT110430.2590993300910918No Hit
TAAAGCTAGAGAACCGAAAGTAA109860.25776195240249344No Hit
TCCCTGAGACCCTAACTTGTG102490.24046989351658066No Hit
AGCTGGTGTTGTGAATCAGGCCG97730.22930161667846063No Hit
TGAGGTAGTAGGTTGTATAGTTT97570.2289262124149944No Hit
TCCCTGAGACCCTTAACCTG97480.22871504751679467No Hit
TTCACCGTGGCTAAGTTCTGC95070.22306052079833472No Hit
AGCTACATTGTCTGCTGGGTTT92260.21646748342120922No Hit
TACCCTGTAGAACCGAATTTGT91380.21440275997214503No Hit
TGAGATGAAGCACTGTAGCTCT90510.21236149928954745No Hit
TCTTTGGTTATCTAGCTGTATGT87470.20522881828368925No Hit
TCCCTGAGACCCTTAACCTGTGT85930.2016155522478269No Hit
TTCCCTTTGTCATCCTATGCCT85620.20088820648736108No Hit
ACCGTGGCTTTAGATTGTTACT84840.19905811070296325No Hit
TGAGNTAGTAGGTTGTATAGTT84230.19762688194849826No Hit
TCCCTGAGACCCTAACTTGTGC83730.19645374362516635No Hit
TTCAAGTAATCCAGGATAGGCTT82810.1942951691102356No Hit
ACCATCGACCGTTGACTGTGCC82350.1932158818527702No Hit
TGAGATGAAGCACTGTAGCTC81340.19084614243963968No Hit
TTCACCGTGGCTAAGTTCTG80910.1898372434815742No Hit
TAAAGCTAGAGAACCGAAAGTAT80850.1896964668827744No Hit
AGCTACATTGTCTGCTGGGTTTC80750.189461839218108No Hit
CCCTGCGACCCTTAACCTGTGA79490.18650553064331152No Hit
CCCTGAGACCCTTAACCTGTGC78710.1846754348589137No Hit
AGAATAATGCCAGCAGTCGGTC76130.1786220411105209No Hit
TGAGGTAGTTGGTTGTATTGTT73880.17334291865552717No Hit
TAAGGCACGCGGTGAATGCC73610.17270942396092792No Hit
TCACNGTGAACCGGTCTCTTT73460.17235748246392835No Hit
AACATTCAACGCTGTCGGTGG70130.16454438123053763No Hit
AAGCTGCCAGTTGAAGAGCTGT69770.16369972163773863No Hit
TCACGGTGAACCGGTCTCTTT69110.16215117905094048No Hit
CACCACGTTCCCGTGG69010.1619165513862741No Hit
CCTTGGCTTTAGACTGCTTACT68350.16036800879947594No Hit
TGAGGTAGTAGGTTGTGTGGTT67450.15825635981747843No Hit
TTCCCTTTGTCATCCTATGCCTG65990.1548307959133492No Hit
AACATTCAACGCTGTCGGTGAGA65390.15342302992535087No Hit
TTCAAGTAATCCAGGATAGGTT64810.15206218947028582No Hit
AACAATCAACGCTGTCGGTGAG63080.1480031308715573No Hit
TCCCNGAGACCCTTAACCTGT61620.14457756696742805No Hit
TCCCGGAGACCCTTAACCTGT61040.143216726512363No Hit
ACCATCGACCGTTGACTGTGCCT57980.13603711997357154No Hit
TAAAGCTAGAGAACCGAAAGTCA56480.13251770500357574No Hit
TACCCTGTAGATCCGGATTTGT56120.13167304541077673No Hit
CTGGACAACTCTTAGCGG55110.12930330599764622No Hit
TACGACCTCAGATCAGACGAGA54980.1289982900335799No Hit
CTTTGGTTATCTAGCTGTATGA54360.12754359851264832No Hit
TGAGGTAGTAGTTTGTGC54150.1270508804168489No Hit
AACATTCAACGCTGTCGGTGT52660.1235549282133197No Hit
AACCCGTAGATCCGAACTTG51650.12118518880018919No Hit
AACCGGTAGATCCGAACTTGTG49860.11698535360266088No Hit
TCACAGTGAACCGGTCTCT49780.11679765147092776No Hit
AACATTCAACGCTGTCGGTG49180.11538988548292943No Hit
AGCAGCATTGTACAGGGCTATGA48350.1134424758661984No Hit
ACCATCGACCGTTGACTGTACC47040.11036885345906873No Hit
CCCTGCGACCCTTAACCTGTGC46000.10792872574653829No Hit
TATTGCACTCGTCCCGGCCT45830.10752985871660545No Hit
TGCTCAGTAGTCAGTGTAGATCC45610.1070136778543394No Hit
TCCCTGAGACCCTTAACCTGTGG45470.10668519912380645No Hit
AACANTCAACGCTGTCGGTGA45170.1059813161298073No Hit
TGAGGTAGTTGTTTGTACAGTT44520.10445623630947576No Hit
TGAGGTAGTAGTTTGTGCTGTTT44440.10426853417774265No Hit
CAGGCTGGTTAGATGGTTGTCT44410.10419814587834275No Hit
AACAGTCAACGCTGTCGGTGA43870.10293115648914425No Hit
TAGCTTATCAGACTGGTGTTGG43630.10236805009394491No Hit
TGTAAACATCCTTGACTGGAAGCT43220.10140607666881273No Hit
TGAGGTAGTAGATTGAATAGTT42840.10051449154308047No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTATAGC58.8735094E-43034.532723
GGCCGCC58.8735094E-43034.532723
AGTATTA58.8735094E-43034.532723
CGGGGGG58.8735094E-43034.532723
TAACACC58.8735094E-43034.532723
TAACACA58.8735094E-43034.532723
AGTTACC58.8735094E-43034.532723
ATAACCA58.8735094E-43034.532723
ACATAGC58.8735094E-43034.532723
AAATAGC202.0299922E-92275.899723
TCAAACA152.618106E-62023.021723
GATTCCT900.01854.436623
TAACTAA254.954927E-91820.719623
AATAACC359.094947E-121734.018823
TCACTGA1150.01715.170823
ACAAATA100.00354862771517.266423
CCGGCGT206.2043564E-61517.266423
CGCATTG206.2043564E-61517.266423
CAACCCG301.0271833E-81517.266423
GCTTCGG100.00354862771517.266423