FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_27_JM66_ATGTCA_L001_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_27_JM66_ATGTCA_L001_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1897048
Sequences flagged as poor quality0
Sequence length1-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG1552688.1847164647389No Hit
TTCAAGTAATCCAGGATAGGCT1319726.956703256849589No Hit
AACATTCAACGCTGTCGGTGAGT877184.623920955083899No Hit
TGAGGTAGTAGGTTGTATAGTT659173.474714398370521No Hit
TCACAGTGAACCGGTCTCTTT405962.139956395410132No Hit
TCCCTGAGACCCTTAACCTGT364081.9191923451594266No Hit
AACATTCAACGCTGTCGGTGA286791.5117698656017138No Hit
TAAAGCTAGAGAACCGAAAGTA268831.4170964572325002No Hit
AACCCGTAGATCCGAACTTGTG243081.2813592486853258No Hit
TAAAGCTAGAGAACCGAAAGT238081.2550025091616026No Hit
TCCCTGAGACCCTTAACCTGTG224461.1832067506989807No Hit
TTCAAGTAATCAAGGATAGGCT199111.0495780813137041No Hit
TATTGCACTCGTCCCGGCCTCC182920.9642349587358885No Hit
TCCAGCATCAGTGATTTTGTT179530.9463650893388043No Hit
TGAGGTAGTAGGTTGTATAGT174630.9205354846055556No Hit
AGCTACATCTGGCTACTGGGTCTC169130.8915430711294602No Hit
TGAGGTAGTAGTTTGTATAGTT149000.7854308378069506No Hit
CCACGTTCCCGTGG146500.772252468045089No Hit
AACATTCAACGATGTCGGTGAG137350.7240196347166756No Hit
TTAAAGGGAATTTGCGACTGTT129650.6834302558501419No Hit
AACATTCATTGCTGTCGGTGGG124510.6563355276197544No Hit
TGAGGTAGTAGTTTGTGCTGTT117000.6167477048551223No Hit
TAAAGCTAGAGAACCGAAAGTC104610.5514357043153362No Hit
TCTTTGGTTATCTAGCTGTAT103530.5457426485782121No Hit
TCCCTGAGACCCTTAACCTGTGA102250.5389953232601389No Hit
TTCACAGTGGCTAAGTTCTGC100130.5278200657020803No Hit
ACCTTGGCTTTAGACTGCTTACT99780.5259750939354196No Hit
TCACAGTGAACCGGTCTCTT99730.5257115265401824No Hit
AACCCGTAGATCCGAACTTGT99270.5232867065039999No Hit
TAACAGTCTACAGTCATGGCT97520.5140618476706967No Hit
TCTTTGGTTATCTAGCTGTATGA91460.48211747936794425No Hit
TTCACAGTGGCTAAGTTCTG89080.46957167135465205No Hit
TCCCTGAGACCCTAACTTGT88680.4674631321927542No Hit
TGAGGTAGTTGGTTGTATAGTT86720.4571312902994547No Hit
TCACAGTGAACCGGTCTCTTTT84030.4429513644356916No Hit
AACATTCAACGATGTCGGTGAGT78840.41559306881006697No Hit
TTCAAGTAATCCAGGATAGGC78710.4149077935824502No Hit
AAGCTGCCAGCTGAAGAACT78620.41443337227102317No Hit
AAGCTGCCAGCTGAAGAACTGT77350.4077387604319975No Hit
CCCTGAGACCCTTAACCTGTGA75940.4003061598863076No Hit
TCTTTGGTTATCTAGCTGTCT75290.3968797837482236No Hit
AACATTCATTGCTGTCGGTGGGT74330.39181928975966873No Hit
TCTTTGGTTATCTAGCTGTCTGA70380.3709974655359274No Hit
TCCCTGAGACCCTAACTTGTGA67000.3531803096178905No Hit
TATTGCACTTGTCCCGGCCTGT62130.32750884532178415No Hit
TCCAGCATCAGTGATTTTGTTG60170.31717700342848465No Hit
TAGCTTATCAGACTGGTGTTGGC59230.3122219363980247No Hit
CCTGTCTGAGGGTCGCT58120.3063707402237582No Hit
TAAAGGGAATTTGCGACTGTT58080.3061598863075684No Hit
TGAGATGAAGCACTGTAGCT55480.29245438175523236No Hit
TTGCATAGTCACAAAAGTGATC54810.28892257865905346No Hit
TGAGGTAGTAGGTTGTATAGTTT54240.28591791035334896No Hit
TAAAGCTAGAGAACCGAAAGTAA53840.28380937119145117No Hit
TCACAGTGAACAGGTCTCTTT53300.28096284332288907No Hit
TTCCCTTTGTCATCCTATGCCT52490.2766930515200459No Hit
AACATTCAACGCTGTCGGTGG52320.2757969223762393No Hit
TACCCTGTAGAACCGAATTTGT51160.2696821588067355No Hit
AACCCGTAGATCCGAACTTGTGA49270.2597193112667681No Hit
AGCTACATCTGGCTACTGGGTCT48510.2557130868591622No Hit
TGAGATGAAGCACTGTAGCTCT47730.2516014354934614No Hit
AGCTACATTGTCTGCTGGGTTT45720.24100602620492473No Hit
TCCCTGAGACCCTAACTTGTG44540.23478583567732603No Hit
TCTTTGGTTATCTAGCTGTATG44040.23215016172495373No Hit
ACCATCGACCGTTGACTGTGCC43380.22867107210782228No Hit
AGAATAATGCCAGCAGTCGGTC43250.22798579688020543No Hit
TCCCTGAGACCATTAACCTGT42950.22640439250878205No Hit
AACATTCNACGCTGTCGGTGAG42050.22166017939451188No Hit
TGAGGTAGTTGGTTGTATTGTT41680.21970978066975635No Hit
TTGCATAGTCACAAAAGTGCTC41540.21897179196309213No Hit
TAAAGCTAGAGAACCGAAAGTAT41320.2178120954240483No Hit
TTCCCTTTGTCATCCTATGCCTG40640.21422757884882196No Hit
TCCCTGAGACCCTTAACCTG39960.21064306227359558No Hit
TTCAAGTAATCCAGGATAGGCTT39670.20911437138121966No Hit
TTCAAGTNATCCAGGATAGGCT36960.1948290185593617No Hit
TAAGGCACGCGGTGAATGCC36890.19446002420602956No Hit
AGCTACATTGTCTGCTGGGTTTC36760.1937747489784128No Hit
TGAGATGAAGCACTGTAGCTC36590.1928786198346062No Hit
AGCTGGTGTTGTGAATCAGGCCG36300.19134992894223024No Hit
TACCCTGTAGATCCGGATTTGT35230.18570958668415347No Hit
TCCCTGAGACCCTTAACCTGTGT35180.18544601928891627No Hit
ACCGTGGCTTTAGATTGTTACT33110.17453432912609487No Hit
TGAGGTAGTAGGTTGTGTGGTT32910.17348005954514592No Hit
TCTTTGGTTATCTAGCTGTCTG32700.17237307648514957No Hit
TAACGGAACCCATAATGCAGCTG32160.16952654861658745No Hit
AACATTCAACGCTGTCGGTGAGA31450.16578389160421877No Hit
AAGCTGCCAGTTGAAGAGCTGT30930.16304279069375155No Hit
CCCTGAGACCCTTAACCTGTGC30820.16246294242422965No Hit
TTCACCGTGGCTAAGTTCTGC30240.15940556063947775No Hit
AACCCGTAGATACGAACTTGTG29160.15371250490235355No Hit
AACATTCAACGCTGTCGGTGT28980.15276366227949953No Hit
TTCAAGTAATCCAGGATAGGTT28980.15276366227949953No Hit
TGTGGTCGGCGTCC28320.14928457266236805No Hit
GTACAGTACTGTGATAACTGA27700.14601633696142638No Hit
TGAGGTAGTTGGTTGTATAGT27450.1446984999852402No Hit
TCCCTGAGACCCTAACTTGTGC27170.14322252257191173No Hit
AACATTCAACGATGTCGGTGA27120.14295895517667448No Hit
TCTTTGGTTATCTAGCTGTATGT27060.14264267430238983No Hit
CTTTGGTTATCTAGCTGTATGA26690.1406922755776343No Hit
TCCCTGAGACCATTAACCTGTG26690.1406922755776343No Hit
TTCACCGTGGCTAAGTTCTG26500.13969071947573283No Hit
TGAGGTAGTAGATTGAATAGTT26350.13890001729002113No Hit
ACCATCGACCGTTGACTGTGCCT25160.132627113283375No Hit
TAACAGTCTACAGCCATGGTCG24870.13109842239099906No Hit
TGAGGTAGTAGTTTGTATAGT24870.13109842239099906No Hit
AACATTCAACGCTGTCGGTG24350.12835732148053186No Hit
ACCGTGGCTTTAGATTGTTCCT24350.12835732148053186No Hit
CCTTGGCTTTAGACTGCTTACT24100.1270394845043457No Hit
AACCCGTAGATCCGAACTTG23950.126248782318634No Hit
TCCCTGAGACCCTTAACCTGTGG23760.12524722621673254No Hit
AACATTCNACGCTGTCGGTGAGT23630.12456195098911572No Hit
CATTGCACTTGTCTCGGTCTGA23450.12361310836626169No Hit
CCCTGCGACCCTTAACCTGTGA22760.11997587831198789No Hit
TGAGGTAGTTGTTTGTACAGTT22390.11802547958723238No Hit
TAACAGTCTACAGCCATGGTC22030.11612779434152432No Hit
TGAGGTAGTAGTTTGTGC21850.11517895171867026No Hit
CTGGACAACTCTTAGCGG21780.11480995736533814No Hit
CACCACGTTCCCGTGG21760.11470453040724325No Hit
TCACAGTGAACCGGTCTCT21410.11285955864058263No Hit
CAGGCTGGTTAGATGGTTGTCT21210.11180528905963372No Hit
TGAGGTAGTAGTTTGTGCTGTTT21170.11159443514344393No Hit
TAAAGCTAGAGAACCGAAAGTCA21170.11159443514344393No Hit
CCCTGAGACCCTTAACCTGTGG20920.11027659816725775No Hit
TGTAAACATCCTACACTCTCAGCT20750.10938046902345118No Hit
TCGTGTCTTGTGTTGCAGCCAGT20700.10911690162821394No Hit
TATGGCTTTTTATTCCTATCTG20320.10711378942441098No Hit
AAGGTCCAACCTCACATGTCCT20020.10553238505298758No Hit
TACCCTGTAGAACCGAATTTGCG19910.10495253678346568No Hit
TCTTTGGTTATCTAGCTGTCTGT19720.10395098068156419No Hit
TGAGGTANTAGGTTGTATAGTT19360.10205329543585613No Hit
AACATTCAACGCTGTCGGTGAT19010.1002083236691955No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AATAACC151.1459633E-104628.49623
ACCACCA53.792803E-44628.495623
CAACCCG53.792803E-44628.495623
TAAAAAA53.792803E-44628.495623
GTTTTTA53.792803E-44628.495623
GCTGAGC53.792803E-44628.495623
ACGATTT53.792803E-44628.495623
AAAACCA102.1498454E-74628.495623
GCACCTT53.792803E-44628.495623
AGCGCCT53.792803E-44628.495623
ACGAACC53.792803E-44628.495623
GGACTCG100.00151690632314.247823
GAAGTGG100.00151690632314.247823
TAACTAA100.00151690632314.247823
GCTGCCC100.00151690632314.247823
GTGACTA100.00151690632314.247823
GATTCCT100.00151690632314.247823
TCACTGA100.00151690632314.247823
ACGCGCT100.00151690632314.247823
TGAGCCA100.00151690632314.247823